Incidental Mutation 'R3753:Prmt2'
ID271322
Institutional Source Beutler Lab
Gene Symbol Prmt2
Ensembl Gene ENSMUSG00000020230
Gene Nameprotein arginine N-methyltransferase 2
SynonymsHrmt1l1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76207222-76237865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76225303 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 116 (D116E)
Ref Sequence ENSEMBL: ENSMUSP00000137725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020452] [ENSMUST00000099571] [ENSMUST00000099572] [ENSMUST00000128099] [ENSMUST00000137857] [ENSMUST00000217726]
Predicted Effect probably benign
Transcript: ENSMUST00000020452
AA Change: D116E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020452
Gene: ENSMUSG00000020230
AA Change: D116E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099571
AA Change: D116E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097166
Gene: ENSMUSG00000020230
AA Change: D116E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099572
AA Change: D116E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097167
Gene: ENSMUSG00000020230
AA Change: D116E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 124 253 3.1e-8 PFAM
Pfam:PRMT5 124 451 1.2e-11 PFAM
Pfam:MTS 137 223 3.3e-10 PFAM
Pfam:Methyltransf_31 147 294 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128099
AA Change: D116E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137707
Gene: ENSMUSG00000020230
AA Change: D116E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.3e-9 PFAM
Pfam:Met_10 122 235 3.8e-8 PFAM
Pfam:TehB 122 235 6.9e-8 PFAM
Pfam:MTS 133 223 2e-11 PFAM
Pfam:Methyltransf_31 147 243 9.3e-9 PFAM
Pfam:Methyltransf_26 150 224 4.6e-10 PFAM
Pfam:Methyltransf_11 154 238 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137857
AA Change: D116E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137725
Gene: ENSMUSG00000020230
AA Change: D116E

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.5e-9 PFAM
Pfam:Met_10 129 235 4.2e-7 PFAM
Pfam:MTS 137 223 1.1e-10 PFAM
Pfam:Methyltransf_31 147 243 9.2e-9 PFAM
Pfam:Methyltransf_11 154 237 1.7e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000217726
AA Change: Q115K
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a hyperplastic response to vascular injury while mutant mouse embryonic fibroblasts show an earlier S phase entry following release of serum starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Prmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Prmt2 APN 10 76222493 missense probably damaging 1.00
IGL01663:Prmt2 APN 10 76217309 splice site probably null
IGL02015:Prmt2 APN 10 76226255 nonsense probably null
IGL03094:Prmt2 APN 10 76210390 splice site probably benign
R0352:Prmt2 UTSW 10 76208503 missense possibly damaging 0.89
R0617:Prmt2 UTSW 10 76208683 intron probably benign
R0831:Prmt2 UTSW 10 76207807 unclassified probably benign
R0885:Prmt2 UTSW 10 76222565 missense probably damaging 1.00
R1882:Prmt2 UTSW 10 76222468 missense probably benign 0.00
R2022:Prmt2 UTSW 10 76225458 nonsense probably null
R2312:Prmt2 UTSW 10 76226255 nonsense probably null
R2401:Prmt2 UTSW 10 76225415 nonsense probably null
R2408:Prmt2 UTSW 10 76208467 missense probably damaging 0.98
R4707:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4785:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4937:Prmt2 UTSW 10 76221008 missense probably damaging 1.00
R5072:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5073:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5074:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5851:Prmt2 UTSW 10 76236740 missense possibly damaging 0.61
R6084:Prmt2 UTSW 10 76210444 missense probably benign 0.23
R6120:Prmt2 UTSW 10 76209446 missense possibly damaging 0.51
R6239:Prmt2 UTSW 10 76222591 nonsense probably null
R6317:Prmt2 UTSW 10 76222517 missense probably benign 0.15
R6659:Prmt2 UTSW 10 76217374 missense possibly damaging 0.85
R7174:Prmt2 UTSW 10 76225339 missense probably benign 0.00
R7421:Prmt2 UTSW 10 76221078 missense probably benign 0.00
R7485:Prmt2 UTSW 10 76221004 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAGCACACTCCTGTCAGG -3'
(R):5'- TGGTGACTGTCTTCCAGCTCAG -3'

Sequencing Primer
(F):5'- ACTCCTGTCAGGTGTCACACG -3'
(R):5'- CCAGCTCAGCTTTTTGAGAGGAG -3'
Posted On2015-03-18