Incidental Mutation 'R3753:Fam187a'
ID271326
Institutional Source Beutler Lab
Gene Symbol Fam187a
Ensembl Gene ENSMUSG00000075510
Gene Namefamily with sequence similarity 187, member A
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102885169-102886731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102885849 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 160 (P160S)
Ref Sequence ENSEMBL: ENSMUSP00000097938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021306] [ENSMUST00000021307] [ENSMUST00000067444] [ENSMUST00000077902] [ENSMUST00000100369] [ENSMUST00000107060] [ENSMUST00000159834]
Predicted Effect probably benign
Transcript: ENSMUST00000021306
SMART Domains Protein: ENSMUSP00000021306
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
Pfam:EFTUD2 3 110 1.1e-42 PFAM
Pfam:GTP_EFTU 127 440 9.6e-47 PFAM
Pfam:GTP_EFTU_D2 489 566 3.8e-15 PFAM
Pfam:EFG_II 584 656 9.9e-11 PFAM
EFG_IV 703 824 1.1e-16 SMART
EFG_C 826 915 1.14e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021307
SMART Domains Protein: ENSMUSP00000021307
Gene: ENSMUSG00000020930

DomainStartEndE-ValueType
Pfam:Dynein_attach_N 7 74 3.3e-32 PFAM
Pfam:RPAP3_C 98 188 1.2e-19 PFAM
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067444
SMART Domains Protein: ENSMUSP00000064691
Gene: ENSMUSG00000020932

DomainStartEndE-ValueType
Pfam:Filament_head 2 64 1.7e-8 PFAM
Filament 65 373 2.34e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077902
SMART Domains Protein: ENSMUSP00000077061
Gene: ENSMUSG00000020932

DomainStartEndE-ValueType
Pfam:Filament_head 1 64 1.6e-7 PFAM
Pfam:Filament 65 373 1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100369
AA Change: P160S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097938
Gene: ENSMUSG00000075510
AA Change: P160S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 39 142 3.73e0 SMART
IG_like 275 361 1.61e1 SMART
transmembrane domain 377 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107060
SMART Domains Protein: ENSMUSP00000102675
Gene: ENSMUSG00000020929

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 32 50 N/A INTRINSIC
Pfam:GTP_EFTU 126 439 9.6e-44 PFAM
Pfam:Miro 130 260 2.5e-6 PFAM
Pfam:GTP_EFTU_D2 488 565 7.9e-13 PFAM
Pfam:EFG_II 583 655 8.2e-10 PFAM
EFG_IV 702 823 1.1e-16 SMART
EFG_C 825 914 1.14e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148209
Predicted Effect probably benign
Transcript: ENSMUST00000159834
SMART Domains Protein: ENSMUSP00000125214
Gene: ENSMUSG00000020930

DomainStartEndE-ValueType
coiled coil region 8 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Fam187a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02569:Fam187a APN 11 102886159 missense probably benign 0.04
IGL02886:Fam187a APN 11 102886554 missense probably benign 0.00
R1735:Fam187a UTSW 11 102885780 missense probably damaging 1.00
R1864:Fam187a UTSW 11 102886011 missense probably damaging 1.00
R2258:Fam187a UTSW 11 102885298 unclassified probably benign
R2259:Fam187a UTSW 11 102885298 unclassified probably benign
R2424:Fam187a UTSW 11 102885954 missense probably damaging 1.00
R4206:Fam187a UTSW 11 102886212 missense probably damaging 0.97
R5176:Fam187a UTSW 11 102886464 missense probably damaging 0.99
R6011:Fam187a UTSW 11 102885441 missense probably damaging 1.00
R6520:Fam187a UTSW 11 102885875 missense possibly damaging 0.52
R6683:Fam187a UTSW 11 102886189 missense probably damaging 1.00
R7309:Fam187a UTSW 11 102886006 missense probably damaging 1.00
R7605:Fam187a UTSW 11 102886048 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TCAGCATCCGCATGTTCAG -3'
(R):5'- AGCTCTGAAACTGCAGCTC -3'

Sequencing Primer
(F):5'- CCGCATGTTCAGCCTGTTGG -3'
(R):5'- CTGGAGATGCAGTTTCCACG -3'
Posted On2015-03-18