Incidental Mutation 'R3753:Prss51'
ID271330
Institutional Source Beutler Lab
Gene Symbol Prss51
Ensembl Gene ENSMUSG00000052099
Gene Nameprotease, serine 51
Synonyms1700007N14Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.290) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64086234-64097678 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 64096175 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063785] [ENSMUST00000165710] [ENSMUST00000170709] [ENSMUST00000224112]
Predicted Effect probably benign
Transcript: ENSMUST00000063785
SMART Domains Protein: ENSMUSP00000066111
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 5 171 3.93e-9 SMART
low complexity region 181 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165710
SMART Domains Protein: ENSMUSP00000132814
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 9 189 2.09e-13 SMART
low complexity region 199 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166038
Predicted Effect probably benign
Transcript: ENSMUST00000170709
SMART Domains Protein: ENSMUSP00000126778
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Pfam:Trypsin 2 94 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224112
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Prss51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Prss51 APN 14 64095984 missense probably damaging 1.00
PIT4354001:Prss51 UTSW 14 64097097 missense probably damaging 0.99
R0453:Prss51 UTSW 14 64097139 missense probably damaging 1.00
R1335:Prss51 UTSW 14 64096171 critical splice donor site probably null
R1479:Prss51 UTSW 14 64096170 critical splice donor site probably null
R5384:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5385:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R5386:Prss51 UTSW 14 64097094 missense probably damaging 0.99
R6522:Prss51 UTSW 14 64097406 missense possibly damaging 0.90
R6722:Prss51 UTSW 14 64095059 missense probably damaging 0.99
R6908:Prss51 UTSW 14 64096152 missense probably benign 0.00
R6919:Prss51 UTSW 14 64097488 missense probably damaging 1.00
R7220:Prss51 UTSW 14 64095995 nonsense probably null
R7510:Prss51 UTSW 14 64096040 missense probably damaging 1.00
R7711:Prss51 UTSW 14 64097488 missense probably damaging 1.00
R7753:Prss51 UTSW 14 64095927 missense possibly damaging 0.86
X0024:Prss51 UTSW 14 64097466 missense probably damaging 1.00
Z1177:Prss51 UTSW 14 64094941 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGAAGATCATTGCTCACAGAGAC -3'
(R):5'- GAGCTTCTTCTAGACCCCATGTG -3'

Sequencing Primer
(F):5'- TTGCTCACAGAGACTACAAACCG -3'
(R):5'- TCTAGACCCCATGTGTTTATCTATG -3'
Posted On2015-03-18