Incidental Mutation 'R3753:Prss51'
ID 271330
Institutional Source Beutler Lab
Gene Symbol Prss51
Ensembl Gene ENSMUSG00000052099
Gene Name serine protease 51
Synonyms 1700007N14Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.394) question?
Stock # R3753 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 64323683-64335127 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 64333624 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063785] [ENSMUST00000165710] [ENSMUST00000170709] [ENSMUST00000224112]
AlphaFold A0A286YDY8
Predicted Effect probably benign
Transcript: ENSMUST00000063785
SMART Domains Protein: ENSMUSP00000066111
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 5 171 3.93e-9 SMART
low complexity region 181 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165710
SMART Domains Protein: ENSMUSP00000132814
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Tryp_SPc 9 189 2.09e-13 SMART
low complexity region 199 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166038
Predicted Effect probably benign
Transcript: ENSMUST00000170709
SMART Domains Protein: ENSMUSP00000126778
Gene: ENSMUSG00000052099

DomainStartEndE-ValueType
Pfam:Trypsin 2 94 2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224112
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,121,677 (GRCm39) I74N probably damaging Het
Acp7 T A 7: 28,316,085 (GRCm39) Y167F probably damaging Het
Acsl1 A T 8: 46,966,602 (GRCm39) probably benign Het
Bcr T C 10: 74,971,772 (GRCm39) V599A probably benign Het
Brd1 C T 15: 88,573,821 (GRCm39) V1093I possibly damaging Het
Cep152 A G 2: 125,466,972 (GRCm39) probably benign Het
Cstf2t T G 19: 31,060,695 (GRCm39) L77R probably damaging Het
Drd3 C T 16: 43,637,466 (GRCm39) R254W probably damaging Het
E2f1 C G 2: 154,405,942 (GRCm39) G144R probably damaging Het
Fam187a C T 11: 102,776,675 (GRCm39) P160S probably benign Het
Fat1 G A 8: 45,478,516 (GRCm39) E2521K probably damaging Het
Fbln1 T A 15: 85,111,279 (GRCm39) C144* probably null Het
Flii T C 11: 60,606,306 (GRCm39) D1128G probably benign Het
Gask1a A T 9: 121,794,899 (GRCm39) D351V probably damaging Het
Gata3 T A 2: 9,873,651 (GRCm39) H281L probably benign Het
Iqsec3 C T 6: 121,353,214 (GRCm39) A1135T probably benign Het
Irak4 T C 15: 94,459,476 (GRCm39) I364T probably damaging Het
Mib2 A G 4: 155,739,741 (GRCm39) F810S probably damaging Het
Nbn G A 4: 15,964,269 (GRCm39) V115I probably damaging Het
Nfyc G T 4: 120,622,527 (GRCm39) probably benign Het
Nup210 A T 6: 90,998,377 (GRCm39) probably null Het
Or2g1 T C 17: 38,107,123 (GRCm39) S263P possibly damaging Het
Or2t48 C T 11: 58,420,516 (GRCm39) A99T probably benign Het
Or8j3b C T 2: 86,205,259 (GRCm39) V166I possibly damaging Het
Paqr8 A G 1: 21,005,856 (GRCm39) T337A probably benign Het
Plce1 T C 19: 38,640,278 (GRCm39) V508A probably benign Het
Prmt2 G T 10: 76,061,137 (GRCm39) D116E probably benign Het
Prune2 T A 19: 17,102,818 (GRCm39) V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 (GRCm39) R6H probably damaging Het
Ramac C T 7: 81,417,395 (GRCm39) R32C probably damaging Het
Rdh12 C T 12: 79,260,446 (GRCm39) R181* probably null Het
Rsf1 T A 7: 97,311,359 (GRCm39) D696E probably benign Het
Sh3rf2 C T 18: 42,244,373 (GRCm39) R280C probably damaging Het
Slco6d1 T A 1: 98,427,502 (GRCm39) I611K probably damaging Het
Snph G A 2: 151,435,374 (GRCm39) P449L probably benign Het
Spg7 G C 8: 123,814,112 (GRCm39) R457P probably damaging Het
Swap70 T A 7: 109,867,088 (GRCm39) W297R probably damaging Het
Tcaf3 T A 6: 42,566,738 (GRCm39) I784F probably damaging Het
Tcstv2c A T 13: 120,616,167 (GRCm39) D2V possibly damaging Het
Tox2 T A 2: 163,156,243 (GRCm39) I138N probably damaging Het
Trim54 A C 5: 31,291,488 (GRCm39) E203A probably damaging Het
Vmn2r19 A T 6: 123,292,548 (GRCm39) T197S possibly damaging Het
Vmn2r28 T A 7: 5,491,026 (GRCm39) H407L probably damaging Het
Wdr19 G A 5: 65,382,069 (GRCm39) V430M probably damaging Het
Other mutations in Prss51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Prss51 APN 14 64,333,433 (GRCm39) missense probably damaging 1.00
PIT4354001:Prss51 UTSW 14 64,334,546 (GRCm39) missense probably damaging 0.99
R0453:Prss51 UTSW 14 64,334,588 (GRCm39) missense probably damaging 1.00
R1335:Prss51 UTSW 14 64,333,620 (GRCm39) critical splice donor site probably null
R1479:Prss51 UTSW 14 64,333,619 (GRCm39) critical splice donor site probably null
R5384:Prss51 UTSW 14 64,334,543 (GRCm39) missense probably damaging 0.99
R5385:Prss51 UTSW 14 64,334,543 (GRCm39) missense probably damaging 0.99
R5386:Prss51 UTSW 14 64,334,543 (GRCm39) missense probably damaging 0.99
R6522:Prss51 UTSW 14 64,334,855 (GRCm39) missense possibly damaging 0.90
R6722:Prss51 UTSW 14 64,332,508 (GRCm39) missense probably damaging 0.99
R6908:Prss51 UTSW 14 64,333,601 (GRCm39) missense probably benign 0.00
R6919:Prss51 UTSW 14 64,334,937 (GRCm39) missense probably damaging 1.00
R7220:Prss51 UTSW 14 64,333,444 (GRCm39) nonsense probably null
R7510:Prss51 UTSW 14 64,333,489 (GRCm39) missense probably damaging 1.00
R7711:Prss51 UTSW 14 64,334,937 (GRCm39) missense probably damaging 1.00
R7753:Prss51 UTSW 14 64,333,376 (GRCm39) missense possibly damaging 0.86
R9000:Prss51 UTSW 14 64,332,420 (GRCm39) missense possibly damaging 0.95
R9164:Prss51 UTSW 14 64,334,958 (GRCm39) missense probably damaging 1.00
R9613:Prss51 UTSW 14 64,332,461 (GRCm39) missense possibly damaging 0.65
X0024:Prss51 UTSW 14 64,334,915 (GRCm39) missense probably damaging 1.00
Z1177:Prss51 UTSW 14 64,332,390 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGAAGATCATTGCTCACAGAGAC -3'
(R):5'- GAGCTTCTTCTAGACCCCATGTG -3'

Sequencing Primer
(F):5'- TTGCTCACAGAGACTACAAACCG -3'
(R):5'- TCTAGACCCCATGTGTTTATCTATG -3'
Posted On 2015-03-18