Incidental Mutation 'R3753:Fbln1'
ID271332
Institutional Source Beutler Lab
Gene Symbol Fbln1
Ensembl Gene ENSMUSG00000006369
Gene Namefibulin 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85205949-85286535 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 85227078 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 144 (C144*)
Ref Sequence ENSEMBL: ENSMUSP00000105058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057410] [ENSMUST00000109432]
Predicted Effect probably null
Transcript: ENSMUST00000057410
AA Change: C144*
SMART Domains Protein: ENSMUSP00000054583
Gene: ENSMUSG00000006369
AA Change: C144*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF 530 580 1.25e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109432
AA Change: C144*
SMART Domains Protein: ENSMUSP00000105058
Gene: ENSMUSG00000006369
AA Change: C144*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF_CA 527 571 7.18e-7 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene develop problems with spontaneous bleeding as embryos. Most die within the first two days of life. Those that survive this period develop normally and eventually recover from their early developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Fbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Fbln1 APN 15 85227037 missense probably benign 0.00
IGL01017:Fbln1 APN 15 85244189 missense possibly damaging 0.94
IGL02514:Fbln1 APN 15 85244262 nonsense probably null
IGL02693:Fbln1 APN 15 85229574 missense probably benign 0.00
IGL02734:Fbln1 APN 15 85226981 missense probably damaging 1.00
IGL02964:Fbln1 APN 15 85231462 missense probably damaging 1.00
IGL03176:Fbln1 APN 15 85244306 missense possibly damaging 0.69
IGL03274:Fbln1 APN 15 85232678 critical splice donor site probably null
R0090:Fbln1 UTSW 15 85224288 missense possibly damaging 0.94
R0148:Fbln1 UTSW 15 85230826 missense probably damaging 0.97
R0393:Fbln1 UTSW 15 85227076 missense probably damaging 0.99
R0564:Fbln1 UTSW 15 85227107 missense probably benign 0.07
R1276:Fbln1 UTSW 15 85229590 missense probably damaging 1.00
R1592:Fbln1 UTSW 15 85231464 missense probably benign 0.00
R1687:Fbln1 UTSW 15 85227106 missense probably benign 0.02
R2312:Fbln1 UTSW 15 85263348 missense probably benign 0.28
R2363:Fbln1 UTSW 15 85227140 critical splice donor site probably null
R3082:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3083:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3751:Fbln1 UTSW 15 85227078 nonsense probably null
R3752:Fbln1 UTSW 15 85227078 nonsense probably null
R4028:Fbln1 UTSW 15 85227116 missense probably benign 0.05
R4406:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4407:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4408:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4612:Fbln1 UTSW 15 85238559 missense probably benign 0.00
R4811:Fbln1 UTSW 15 85226966 critical splice acceptor site probably null
R5022:Fbln1 UTSW 15 85237626 missense probably damaging 0.99
R5121:Fbln1 UTSW 15 85237671 missense probably damaging 1.00
R7231:Fbln1 UTSW 15 85206152 missense unknown
R7285:Fbln1 UTSW 15 85237628 missense probably benign 0.01
R7492:Fbln1 UTSW 15 85227061 missense probably damaging 1.00
R7742:Fbln1 UTSW 15 85240716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTTCTGAGAACACCGAC -3'
(R):5'- TTGGTAGAATCCAGAAATGTGACAC -3'

Sequencing Primer
(F):5'- AGGTTCTTTCGAGGTCCCAAG -3'
(R):5'- CCCACAGGAAGGGTAAGTCAC -3'
Posted On2015-03-18