Incidental Mutation 'R3753:Brd1'
ID271333
Institutional Source Beutler Lab
Gene Symbol Brd1
Ensembl Gene ENSMUSG00000022387
Gene Namebromodomain containing 1
Synonyms1110059H06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location88687034-88734233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88689618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1093 (V1093I)
Ref Sequence ENSEMBL: ENSMUSP00000105007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109380] [ENSMUST00000109381]
Predicted Effect probably benign
Transcript: ENSMUST00000109380
AA Change: V962I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387
AA Change: V962I

DomainStartEndE-ValueType
Pfam:EPL1 46 196 3.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 836 869 N/A INTRINSIC
PWWP 927 1010 2.25e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109381
AA Change: V1093I

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387
AA Change: V1093I

DomainStartEndE-ValueType
Pfam:EPL1 47 196 3.9e-37 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 857 876 N/A INTRINSIC
low complexity region 887 898 N/A INTRINSIC
low complexity region 967 1000 N/A INTRINSIC
PWWP 1058 1141 2.25e-39 SMART
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Brd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd1 APN 15 88730158 missense probably benign 0.38
IGL00924:Brd1 APN 15 88729409 missense possibly damaging 0.80
IGL01626:Brd1 APN 15 88700887 missense probably damaging 1.00
IGL02569:Brd1 APN 15 88713929 missense probably damaging 1.00
IGL02646:Brd1 APN 15 88700877 missense probably damaging 1.00
IGL03130:Brd1 APN 15 88688374 missense probably benign
IGL03343:Brd1 APN 15 88707251 missense possibly damaging 0.89
spry UTSW 15 88688355 missense possibly damaging 0.47
R0089:Brd1 UTSW 15 88701198 missense probably benign 0.06
R0112:Brd1 UTSW 15 88730383 missense probably benign
R0165:Brd1 UTSW 15 88729777 missense probably damaging 0.99
R0965:Brd1 UTSW 15 88717028 missense probably damaging 1.00
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1534:Brd1 UTSW 15 88689663 missense possibly damaging 0.68
R2245:Brd1 UTSW 15 88689860 critical splice donor site probably null
R3611:Brd1 UTSW 15 88700944 missense probably benign
R3751:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3752:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3801:Brd1 UTSW 15 88717040 missense probably damaging 1.00
R4956:Brd1 UTSW 15 88730113 missense probably damaging 1.00
R5382:Brd1 UTSW 15 88729564 missense probably damaging 1.00
R5546:Brd1 UTSW 15 88701122 missense probably benign 0.00
R5659:Brd1 UTSW 15 88713381 missense probably benign 0.14
R5730:Brd1 UTSW 15 88717045 missense probably benign 0.05
R5773:Brd1 UTSW 15 88689549 missense probably benign 0.14
R6224:Brd1 UTSW 15 88688355 missense possibly damaging 0.47
R6371:Brd1 UTSW 15 88713998 missense probably benign
R7096:Brd1 UTSW 15 88713935 missense probably damaging 1.00
R7722:Brd1 UTSW 15 88729559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTAGGCAGCAGCAGAC -3'
(R):5'- AGTTCCTCTGCTGCCAAAGG -3'

Sequencing Primer
(F):5'- TTACTCAGCATGGGTCAAGC -3'
(R):5'- CCTCTGCTGCCAAAGGTGTATG -3'
Posted On2015-03-18