Incidental Mutation 'R3753:Irak4'
ID271335
Institutional Source Beutler Lab
Gene Symbol Irak4
Ensembl Gene ENSMUSG00000059883
Gene Nameinterleukin-1 receptor-associated kinase 4
SynonymsIRAK-4, 8430405M07Rik, NY-REN-64, 9330209D03Rik
Accession Numbers

Ncbi RefSeq: NM_029926; VEGA: OTTMUST00000040437; MGI: 2182474

Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94543643-94581815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94561595 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 364 (I364T)
Ref Sequence ENSEMBL: ENSMUSP00000104871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074936] [ENSMUST00000109248]
Predicted Effect probably damaging
Transcript: ENSMUST00000074936
AA Change: I364T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883
AA Change: I364T

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109248
AA Change: I364T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883
AA Change: I364T

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138306
Meta Mutation Damage Score 0.6371 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice exhibit defects of the innate immune system and show increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Chemically induced(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Irak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Irak4 APN 15 94556628 missense probably benign 0.09
IGL00688:Irak4 APN 15 94566863 missense possibly damaging 0.68
IGL01870:Irak4 APN 15 94547870 missense probably benign 0.28
IGL02740:Irak4 APN 15 94567044 makesense probably null
IGL02897:Irak4 APN 15 94553991 missense probably benign 0.00
IGL03290:Irak4 APN 15 94551899 missense probably benign 0.01
otiose UTSW 15 94561484 missense probably damaging 1.00
R0057:Irak4 UTSW 15 94553872 missense probably benign 0.00
R2010:Irak4 UTSW 15 94551806 missense probably damaging 1.00
R3751:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3752:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3973:Irak4 UTSW 15 94554740 missense possibly damaging 0.73
R4687:Irak4 UTSW 15 94566823 missense probably damaging 1.00
R4704:Irak4 UTSW 15 94566900 splice site probably null
R5001:Irak4 UTSW 15 94558273 missense possibly damaging 0.91
R5392:Irak4 UTSW 15 94556684 missense probably benign
R5392:Irak4 UTSW 15 94556685 missense probably benign 0.39
R6280:Irak4 UTSW 15 94551810 nonsense probably null
R6390:Irak4 UTSW 15 94561486 missense probably damaging 1.00
R7643:Irak4 UTSW 15 94558828 missense probably benign 0.05
V8831:Irak4 UTSW 15 94561484 missense probably damaging 1.00
X0019:Irak4 UTSW 15 94554000 missense probably benign 0.00
X0027:Irak4 UTSW 15 94551930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGTTTTCCACCTTCAAAT -3'
(R):5'- AAAGACTCATGCACCAAAATATTCT -3'

Sequencing Primer
(F):5'- CTGACTTTGGGCTTGCA -3'
(R):5'- GCTTAGCAAAGTAAAGGCTCCTGC -3'
Posted On2015-03-18