Incidental Mutation 'R3753:Drd3'
ID271336
Institutional Source Beutler Lab
Gene Symbol Drd3
Ensembl Gene ENSMUSG00000022705
Gene Namedopamine receptor D3
SynonymsD3 receptor, D3R
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location43754026-43822932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43817103 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 254 (R254W)
Ref Sequence ENSEMBL: ENSMUSP00000155033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023390] [ENSMUST00000229953]
Predicted Effect probably damaging
Transcript: ENSMUST00000023390
AA Change: R222W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023390
Gene: ENSMUSG00000022705
AA Change: R222W

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 234 4.5e-9 PFAM
Pfam:7tm_1 46 429 5.9e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229953
AA Change: R254W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D3 subtype of the five (D1-D5) dopamine receptors. The activity of the D3 subtype receptor is mediated by G proteins which inhibit adenylyl cyclase. This receptor is localized to the limbic areas of the brain, which are associated with cognitive, emotional, and endocrine functions. Genetic variation in this gene may be associated with susceptibility to hereditary essential tremor 1. Alternative splicing of this gene results in transcript variants encoding different isoforms, although some variants may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show exploratory hyperactivity and increased locomotion and rearing behavior, with heterozygous mice displaying similar, but less pronounced, behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Drd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Drd3 APN 16 43762321 missense probably benign 0.01
IGL01715:Drd3 APN 16 43821268 missense probably damaging 0.98
IGL01944:Drd3 APN 16 43818308 missense probably benign 0.16
IGL02212:Drd3 APN 16 43762312 missense probably benign 0.21
IGL02666:Drd3 APN 16 43816956 splice site probably benign
R0529:Drd3 UTSW 16 43822714 missense probably damaging 1.00
R1102:Drd3 UTSW 16 43762483 missense probably damaging 1.00
R1310:Drd3 UTSW 16 43821529 missense probably damaging 0.96
R1548:Drd3 UTSW 16 43821341 missense probably benign 0.01
R3124:Drd3 UTSW 16 43822792 missense probably damaging 1.00
R4363:Drd3 UTSW 16 43762359 missense probably damaging 1.00
R4724:Drd3 UTSW 16 43822801 nonsense probably null
R4725:Drd3 UTSW 16 43822801 nonsense probably null
R4726:Drd3 UTSW 16 43822801 nonsense probably null
R5016:Drd3 UTSW 16 43762246 missense possibly damaging 0.88
R5850:Drd3 UTSW 16 43818332 missense probably benign 0.00
R6052:Drd3 UTSW 16 43821283 missense probably benign 0.01
R6377:Drd3 UTSW 16 43821307 nonsense probably null
R6888:Drd3 UTSW 16 43817139 missense probably benign 0.22
R6928:Drd3 UTSW 16 43821320 missense probably benign 0.16
R7031:Drd3 UTSW 16 43762498 missense probably damaging 0.98
R7089:Drd3 UTSW 16 43807378 missense probably damaging 1.00
R7447:Drd3 UTSW 16 43817063 nonsense probably null
R7567:Drd3 UTSW 16 43822684 missense probably benign 0.00
R7575:Drd3 UTSW 16 43817133 missense probably benign 0.11
R7772:Drd3 UTSW 16 43762395 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCACACGCCCCATATCATG -3'
(R):5'- GATGCGATGACATCTGTCTCC -3'

Sequencing Primer
(F):5'- TGCTCCACACTGAGGATAATTG -3'
(R):5'- ATGCGATGACATCTGTCTCCTAAGTG -3'
Posted On2015-03-18