Incidental Mutation 'R3753:Olfr123'
ID271337
Institutional Source Beutler Lab
Gene Symbol Olfr123
Ensembl Gene ENSMUSG00000045202
Gene Nameolfactory receptor 123
SynonymsMOR256-9, GA_x6K02T2PSCP-2255106-2256035
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37793529-37798134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37796232 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 263 (S263P)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478] [ENSMUST00000217365]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054748
AA Change: S263P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: S263P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174446
Predicted Effect possibly damaging
Transcript: ENSMUST00000214770
AA Change: S263P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect possibly damaging
Transcript: ENSMUST00000216051
AA Change: S263P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Predicted Effect probably benign
Transcript: ENSMUST00000217365
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Olfr123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Olfr123 APN 17 37795522 missense probably damaging 0.99
IGL03030:Olfr123 APN 17 37796271 missense probably damaging 1.00
IGL03107:Olfr123 APN 17 37795788 missense probably benign 0.01
R0329:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0330:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0524:Olfr123 UTSW 17 37795605 nonsense probably null
R0581:Olfr123 UTSW 17 37796102 missense probably damaging 1.00
R1288:Olfr123 UTSW 17 37795693 missense probably damaging 0.98
R1897:Olfr123 UTSW 17 37796184 missense probably benign 0.22
R3751:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3780:Olfr123 UTSW 17 37796004 missense probably damaging 1.00
R3947:Olfr123 UTSW 17 37796115 missense probably benign
R5925:Olfr123 UTSW 17 37795591 missense probably benign 0.00
R5987:Olfr123 UTSW 17 37796357 missense probably benign
R6369:Olfr123 UTSW 17 37795496 missense probably benign 0.02
R6891:Olfr123 UTSW 17 37795504 missense probably benign
R7320:Olfr123 UTSW 17 37796357 missense probably benign
R7997:Olfr123 UTSW 17 37796162 nonsense probably null
R8153:Olfr123 UTSW 17 37795476 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTCATTGGTCTTGCTG -3'
(R):5'- GCCAAGATGACTTCAGTGCAAC -3'

Sequencing Primer
(F):5'- GCTCCTACCCTTAGCCCTGATAC -3'
(R):5'- ATGACAGTATGTTCAGGATCCTC -3'
Posted On2015-03-18