Incidental Mutation 'R3753:Sh3rf2'
ID271339
Institutional Source Beutler Lab
Gene Symbol Sh3rf2
Ensembl Gene ENSMUSG00000057719
Gene NameSH3 domain containing ring finger 2
Synonyms9130023G24Rik, RNF158
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42053667-42158960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42111308 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 280 (R280C)
Ref Sequence ENSEMBL: ENSMUSP00000074247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072008] [ENSMUST00000074679]
Predicted Effect probably damaging
Transcript: ENSMUST00000072008
AA Change: R312C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071896
Gene: ENSMUSG00000057719
AA Change: R312C

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
SH3 190 251 1.45e-13 SMART
low complexity region 357 366 N/A INTRINSIC
SH3 385 442 3.27e-12 SMART
low complexity region 500 514 N/A INTRINSIC
low complexity region 614 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074679
AA Change: R280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074247
Gene: ENSMUSG00000057719
AA Change: R280C

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
low complexity region 325 334 N/A INTRINSIC
SH3 353 410 3.27e-12 SMART
low complexity region 468 482 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Sh3rf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Sh3rf2 APN 18 42111218 missense probably benign 0.00
IGL01012:Sh3rf2 APN 18 42054192 missense possibly damaging 0.50
IGL01286:Sh3rf2 APN 18 42139611 critical splice donor site probably null
IGL02369:Sh3rf2 APN 18 42156157 nonsense probably null
IGL02563:Sh3rf2 APN 18 42156142 missense probably damaging 0.99
PIT4445001:Sh3rf2 UTSW 18 42153164 missense probably benign 0.00
R0141:Sh3rf2 UTSW 18 42156057 missense probably benign 0.02
R0270:Sh3rf2 UTSW 18 42104081 missense probably damaging 0.99
R1447:Sh3rf2 UTSW 18 42101671 missense probably benign 0.00
R1491:Sh3rf2 UTSW 18 42053939 missense probably damaging 0.99
R1539:Sh3rf2 UTSW 18 42149822 missense probably damaging 1.00
R1595:Sh3rf2 UTSW 18 42111288 missense probably damaging 1.00
R1749:Sh3rf2 UTSW 18 42153294 missense probably damaging 1.00
R1864:Sh3rf2 UTSW 18 42053981 missense probably damaging 0.99
R1942:Sh3rf2 UTSW 18 42149624 missense probably damaging 1.00
R1998:Sh3rf2 UTSW 18 42141083 missense probably damaging 0.99
R2331:Sh3rf2 UTSW 18 42053863 missense probably benign 0.04
R2680:Sh3rf2 UTSW 18 42101650 missense probably damaging 0.98
R2938:Sh3rf2 UTSW 18 42149724 missense probably benign 0.09
R2940:Sh3rf2 UTSW 18 42111440 critical splice donor site probably null
R3861:Sh3rf2 UTSW 18 42153319 missense probably damaging 1.00
R4322:Sh3rf2 UTSW 18 42111399 missense probably damaging 1.00
R5076:Sh3rf2 UTSW 18 42053924 missense probably damaging 1.00
R5169:Sh3rf2 UTSW 18 42153061 missense probably benign 0.00
R5228:Sh3rf2 UTSW 18 42153181 missense possibly damaging 0.69
R5437:Sh3rf2 UTSW 18 42141014 missense probably benign 0.44
R5792:Sh3rf2 UTSW 18 42111138 missense probably damaging 0.99
R5820:Sh3rf2 UTSW 18 42141047 missense possibly damaging 0.94
R6159:Sh3rf2 UTSW 18 42156135 missense probably damaging 0.96
R6366:Sh3rf2 UTSW 18 42153065 missense probably benign 0.00
R6640:Sh3rf2 UTSW 18 42101640 missense probably damaging 1.00
R6897:Sh3rf2 UTSW 18 42101605 missense possibly damaging 0.91
R6995:Sh3rf2 UTSW 18 42101541 missense probably damaging 1.00
R7097:Sh3rf2 UTSW 18 42104162 splice site probably null
R7122:Sh3rf2 UTSW 18 42104162 splice site probably null
R7432:Sh3rf2 UTSW 18 42054026 missense probably damaging 0.99
R7444:Sh3rf2 UTSW 18 42101539 missense probably damaging 1.00
R7654:Sh3rf2 UTSW 18 42104108 missense probably damaging 1.00
R7703:Sh3rf2 UTSW 18 42156136 missense probably benign 0.04
R7732:Sh3rf2 UTSW 18 42101688 missense probably damaging 1.00
R7835:Sh3rf2 UTSW 18 42111170 missense probably benign 0.25
R7918:Sh3rf2 UTSW 18 42111170 missense probably benign 0.25
R8053:Sh3rf2 UTSW 18 42153022 missense probably damaging 1.00
R8144:Sh3rf2 UTSW 18 42141059 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTATCCTTGCAGCCAAACGTC -3'
(R):5'- AATAGTGCTTAGGACGTGGTGAC -3'

Sequencing Primer
(F):5'- GCCAAACGTCTCGGCAAG -3'
(R):5'- GTGACGCATTCTTGCCTAGTGC -3'
Posted On2015-03-18