Incidental Mutation 'R3754:Gad2'
ID271343
Institutional Source Beutler Lab
Gene Symbol Gad2
Ensembl Gene ENSMUSG00000026787
Gene Nameglutamic acid decarboxylase 2
SynonymsGad-2, 6330404F12Rik, GAD(65), GAD65
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3754 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22622205-22693874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22681340 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 430 (D430V)
Ref Sequence ENSEMBL: ENSMUSP00000028123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028123
AA Change: D430V

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787
AA Change: D430V

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 138 509 7.8e-138 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,229,455 probably null Het
Atp12a G A 14: 56,372,588 V182I probably benign Het
Gm9833 G A 3: 10,088,515 V115I possibly damaging Het
Hr A G 14: 70,567,824 E1002G probably damaging Het
Itpkc G T 7: 27,228,432 P19Q probably damaging Het
Lrrc72 A G 12: 36,212,568 S42P probably benign Het
Med1 A G 11: 98,166,722 V318A possibly damaging Het
Nek11 A T 9: 105,314,718 N164K probably damaging Het
Neurod2 A G 11: 98,327,700 S213P probably damaging Het
Nhsl1 A G 10: 18,516,034 N179D probably damaging Het
Nr2f2 T C 7: 70,358,021 I238V probably benign Het
Rpl37 C A 15: 5,117,288 T2K possibly damaging Het
Slf2 A G 19: 44,973,237 D1065G probably benign Het
Smim5 T C 11: 115,905,723 C57R probably damaging Het
Soat2 T A 15: 102,157,078 V236D probably damaging Het
Teddm3 C T 16: 21,153,148 D224N possibly damaging Het
Tm2d2 G A 8: 25,020,478 V118I probably damaging Het
Ttc22 C A 4: 106,639,081 R443S probably damaging Het
Upf1 A G 8: 70,339,814 I368T probably benign Het
Xrn1 G T 9: 95,967,788 D129Y probably damaging Het
Zfp109 A G 7: 24,229,756 M76T probably benign Het
Znrf1 G A 8: 111,619,211 V76M probably damaging Het
Other mutations in Gad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Gad2 APN 2 22685386 missense probably benign 0.07
IGL00870:Gad2 APN 2 22629971 missense probably benign 0.42
IGL01142:Gad2 APN 2 22681285 splice site probably benign
IGL01577:Gad2 APN 2 22681280 splice site probably benign
IGL01671:Gad2 APN 2 22623699 nonsense probably null
IGL02346:Gad2 APN 2 22629939 splice site probably benign
IGL02348:Gad2 APN 2 22629393 missense probably damaging 1.00
IGL03113:Gad2 APN 2 22681355 missense probably benign 0.09
gruene UTSW 2 22685067 critical splice donor site probably null
Mosey UTSW 2 22668257 missense probably damaging 1.00
R0630:Gad2 UTSW 2 22690336 missense probably benign 0.14
R1109:Gad2 UTSW 2 22681394 missense probably damaging 1.00
R1109:Gad2 UTSW 2 22690159 splice site probably benign
R1122:Gad2 UTSW 2 22623451 missense possibly damaging 0.68
R1604:Gad2 UTSW 2 22623840 critical splice donor site probably null
R1773:Gad2 UTSW 2 22690207 missense probably benign
R1895:Gad2 UTSW 2 22685428 missense probably benign
R1946:Gad2 UTSW 2 22685428 missense probably benign
R2329:Gad2 UTSW 2 22668289 missense probably damaging 1.00
R2857:Gad2 UTSW 2 22673975 missense probably benign 0.02
R3847:Gad2 UTSW 2 22684988 missense probably benign 0.00
R4382:Gad2 UTSW 2 22685410 missense probably benign
R4383:Gad2 UTSW 2 22685410 missense probably benign
R4384:Gad2 UTSW 2 22685410 missense probably benign
R4651:Gad2 UTSW 2 22668362 missense probably damaging 1.00
R4700:Gad2 UTSW 2 22673970 missense probably damaging 1.00
R4766:Gad2 UTSW 2 22622667 missense probably damaging 0.99
R5279:Gad2 UTSW 2 22673957 missense probably benign 0.38
R5372:Gad2 UTSW 2 22690243 missense possibly damaging 0.84
R5505:Gad2 UTSW 2 22624833 missense probably benign
R5820:Gad2 UTSW 2 22690249 missense probably benign 0.00
R5868:Gad2 UTSW 2 22685067 critical splice donor site probably null
R6026:Gad2 UTSW 2 22623736 missense probably benign 0.00
R6497:Gad2 UTSW 2 22668257 missense probably damaging 1.00
R6675:Gad2 UTSW 2 22673985 missense possibly damaging 0.67
R7157:Gad2 UTSW 2 22635023 missense probably damaging 0.98
R7352:Gad2 UTSW 2 22623823 missense probably benign 0.00
R7951:Gad2 UTSW 2 22623487 missense probably damaging 0.96
R8285:Gad2 UTSW 2 22624928 missense probably benign 0.45
X0019:Gad2 UTSW 2 22690172 critical splice acceptor site probably null
Z1177:Gad2 UTSW 2 22635014 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTGCCTGGACAGTCTTATCC -3'
(R):5'- CTTGCCCATGGAGAATGCAG -3'

Sequencing Primer
(F):5'- GGACAGTCTTATCCAGTAGTTTTTC -3'
(R):5'- CCCATGGAGAATGCAGCCATG -3'
Posted On2015-03-18