Incidental Mutation 'R3755:Fabp3'
ID 271383
Institutional Source Beutler Lab
Gene Symbol Fabp3
Ensembl Gene ENSMUSG00000028773
Gene Name fatty acid binding protein 3, muscle and heart
Synonyms Fabph-1, Fabp3, Fabph4, H-FABP, Mdgi, Fabph1, Fabph-4
MMRRC Submission 040738-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3755 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 130202531-130209256 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130206180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 57 (T57I)
Ref Sequence ENSEMBL: ENSMUSP00000070709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070532] [ENSMUST00000097865] [ENSMUST00000134159]
AlphaFold P11404
Predicted Effect probably benign
Transcript: ENSMUST00000070532
AA Change: T57I

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070709
Gene: ENSMUSG00000028773
AA Change: T57I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 3.2e-13 PFAM
Pfam:Lipocalin 6 132 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097865
SMART Domains Protein: ENSMUSP00000095477
Gene: ENSMUSG00000073752

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Meta Mutation Damage Score 0.7568 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Inactivation of this locus results in impaired fatty acid utilization. Homozygous null mice show exercise intolerance and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,098,110 (GRCm39) S169Y probably damaging Het
Abcb1a G A 5: 8,797,403 (GRCm39) V1225M possibly damaging Het
Adamdec1 A T 14: 68,814,587 (GRCm39) I130N probably damaging Het
Atf7ip T A 6: 136,537,815 (GRCm39) N357K probably benign Het
Bace2 C G 16: 97,237,857 (GRCm39) T436R probably benign Het
Capn13 G A 17: 73,638,114 (GRCm39) Q430* probably null Het
Ccdc30 A T 4: 119,225,005 (GRCm39) probably null Het
Ces5a T C 8: 94,255,130 (GRCm39) T184A probably benign Het
Cntnap5c T C 17: 58,411,594 (GRCm39) C493R possibly damaging Het
Creb3l2 A T 6: 37,340,961 (GRCm39) I146N possibly damaging Het
Erich3 A G 3: 154,469,958 (GRCm39) probably benign Het
Etl4 G A 2: 20,748,348 (GRCm39) V27I probably benign Het
Fsip2 G A 2: 82,808,561 (GRCm39) D1627N probably benign Het
Gcdh A G 8: 85,620,109 (GRCm39) probably benign Het
Kcna7 T C 7: 45,058,369 (GRCm39) F219L probably benign Het
Kdm3b T C 18: 34,941,349 (GRCm39) L280S probably benign Het
Knl1 T A 2: 118,933,060 (GRCm39) V2073D probably damaging Het
Kprp A G 3: 92,732,346 (GRCm39) S235P unknown Het
Lpp A G 16: 24,663,911 (GRCm39) H396R probably benign Het
Lrch4 T A 5: 137,635,992 (GRCm39) D348E probably damaging Het
Mcm9 T C 10: 53,502,048 (GRCm39) N179S probably benign Het
Mettl13 T C 1: 162,371,789 (GRCm39) E360G probably damaging Het
Nfib A T 4: 82,241,936 (GRCm39) S418R probably damaging Het
Or52b1 A G 7: 104,979,358 (GRCm39) F14L probably damaging Het
Or8s2 A C 15: 98,276,463 (GRCm39) I176S probably benign Het
Pcdha8 G A 18: 37,126,741 (GRCm39) V408M probably damaging Het
Pcdhb3 T C 18: 37,435,878 (GRCm39) F615L probably damaging Het
Pkd1l3 C T 8: 110,359,171 (GRCm39) T844I probably damaging Het
Pkhd1l1 A T 15: 44,452,802 (GRCm39) E3909V probably damaging Het
Poldip3 A G 15: 83,015,676 (GRCm39) probably benign Het
Ptpn1 T C 2: 167,816,143 (GRCm39) I219T probably damaging Het
Rad18 T C 6: 112,670,432 (GRCm39) N44S probably damaging Het
Reep5 T C 18: 34,505,527 (GRCm39) Y48C probably damaging Het
Rgl2 C A 17: 34,151,571 (GRCm39) A205D probably benign Het
Rundc3a A G 11: 102,290,085 (GRCm39) I175V possibly damaging Het
Slamf1 C T 1: 171,604,728 (GRCm39) A166V probably damaging Het
Slc4a5 A G 6: 83,265,285 (GRCm39) D693G probably benign Het
Snap23 T A 2: 120,416,726 (GRCm39) C79S probably damaging Het
Spag6l A C 16: 16,580,884 (GRCm39) probably null Het
Trappc13 C T 13: 104,305,068 (GRCm39) D40N probably benign Het
Trav4-3 C A 14: 53,836,596 (GRCm39) S20R probably benign Het
Tssk2 G A 16: 17,716,827 (GRCm39) E77K probably damaging Het
Ubap2 A G 4: 41,195,482 (GRCm39) F1051S probably damaging Het
Ugt3a1 A G 15: 9,367,498 (GRCm39) T414A probably benign Het
Urod C T 4: 116,850,601 (GRCm39) C66Y probably damaging Het
Vmn1r234 A G 17: 21,449,271 (GRCm39) K62E probably damaging Het
Wiz A G 17: 32,578,106 (GRCm39) S460P probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb7a C T 10: 80,980,100 (GRCm39) T98M probably damaging Het
Zfp524 C A 7: 5,020,884 (GRCm39) H137Q probably damaging Het
Other mutations in Fabp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
cardio UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1111:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1112:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1114:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1116:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1144:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1146:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1146:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1147:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1147:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1460:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1505:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1506:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1508:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1509:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1582:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1601:Fabp3 UTSW 4 130,202,641 (GRCm39) missense probably benign 0.24
R1612:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1641:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1664:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1670:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1686:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1690:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1709:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1854:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1855:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R1935:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2107:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2208:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2211:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2392:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2393:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2829:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2830:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2831:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2901:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2964:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2975:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2979:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2980:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2981:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2982:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R2983:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R3430:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R3612:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R3613:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R3614:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R3756:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R3825:Fabp3 UTSW 4 130,206,245 (GRCm39) splice site probably null
R3842:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4012:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4280:Fabp3 UTSW 4 130,206,245 (GRCm39) splice site probably null
R4282:Fabp3 UTSW 4 130,206,245 (GRCm39) splice site probably null
R4405:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4406:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4466:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4503:Fabp3 UTSW 4 130,206,245 (GRCm39) splice site probably null
R4547:Fabp3 UTSW 4 130,206,245 (GRCm39) splice site probably null
R4548:Fabp3 UTSW 4 130,206,245 (GRCm39) splice site probably null
R4671:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4681:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4710:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4743:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4850:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R4989:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R5015:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R5133:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R5134:Fabp3 UTSW 4 130,206,180 (GRCm39) missense probably benign 0.21
R5549:Fabp3 UTSW 4 130,209,018 (GRCm39) makesense probably null
R5884:Fabp3 UTSW 4 130,206,131 (GRCm39) missense probably benign 0.01
R7170:Fabp3 UTSW 4 130,207,763 (GRCm39) missense probably benign 0.06
R7967:Fabp3 UTSW 4 130,207,781 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCACAAACTTCTCTTTGG -3'
(R):5'- GCTTATACTTAGTCCCTGGGC -3'

Sequencing Primer
(F):5'- GGGTCTATATAACACGTCTCTACC -3'
(R):5'- CACTGAGCAGGCTTTATGAACCTG -3'
Posted On 2015-03-18