Incidental Mutation 'R3755:Rad18'
ID271389
Institutional Source Beutler Lab
Gene Symbol Rad18
Ensembl Gene ENSMUSG00000030254
Gene NameRAD18 E3 ubiquitin protein ligase
Synonyms2810024C04Rik
MMRRC Submission 040738-MU
Accession Numbers

Genbank: NM_001167730, NM_021385; MGI: 1890476

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3755 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location112619850-112696686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112693471 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 44 (N44S)
Ref Sequence ENSEMBL: ENSMUSP00000138558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000156063]
Predicted Effect probably damaging
Transcript: ENSMUST00000068487
AA Change: N44S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: N44S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
internal_repeat_1 398 422 2.94e-14 PROSPERO
internal_repeat_1 422 446 2.94e-14 PROSPERO
low complexity region 473 488 N/A INTRINSIC
low complexity region 495 507 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077088
AA Change: N44S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254
AA Change: N44S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
PDB:2YBF|B 340 363 7e-6 PDB
internal_repeat_1 372 396 1.24e-14 PROSPERO
internal_repeat_1 396 420 1.24e-14 PROSPERO
low complexity region 447 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113180
AA Change: N44S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254
AA Change: N44S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113182
AA Change: N44S

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: N44S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
low complexity region 388 400 N/A INTRINSIC
low complexity region 407 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135092
Predicted Effect probably damaging
Transcript: ENSMUST00000156063
AA Change: N44S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138558
Gene: ENSMUSG00000030254
AA Change: N44S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180959
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI

 All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,222,114 S169Y probably damaging Het
Abcb1a G A 5: 8,747,403 V1225M possibly damaging Het
Adamdec1 A T 14: 68,577,138 I130N probably damaging Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Bace2 C G 16: 97,436,657 T436R probably benign Het
Capn13 G A 17: 73,331,119 Q430* probably null Het
Ccdc30 A T 4: 119,367,808 probably null Het
Ces5a T C 8: 93,528,502 T184A probably benign Het
Cntnap5c T C 17: 58,104,599 C493R possibly damaging Het
Creb3l2 A T 6: 37,364,026 I146N possibly damaging Het
Erich3 A G 3: 154,764,321 probably benign Het
Etl4 G A 2: 20,743,537 V27I probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fsip2 G A 2: 82,978,217 D1627N probably benign Het
Gcdh A G 8: 84,893,480 probably benign Het
Kcna7 T C 7: 45,408,945 F219L probably benign Het
Kdm3b T C 18: 34,808,296 L280S probably benign Het
Knl1 T A 2: 119,102,579 V2073D probably damaging Het
Kprp A G 3: 92,825,039 S235P unknown Het
Lpp A G 16: 24,845,161 H396R probably benign Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mcm9 T C 10: 53,625,952 N179S probably benign Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Nfib A T 4: 82,323,699 S418R probably damaging Het
Olfr283 A C 15: 98,378,582 I176S probably benign Het
Olfr690 A G 7: 105,330,151 F14L probably damaging Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pkd1l3 C T 8: 109,632,539 T844I probably damaging Het
Pkhd1l1 A T 15: 44,589,406 E3909V probably damaging Het
Poldip3 A G 15: 83,131,475 probably benign Het
Ptpn1 T C 2: 167,974,223 I219T probably damaging Het
Reep5 T C 18: 34,372,474 Y48C probably damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Slamf1 C T 1: 171,777,160 A166V probably damaging Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Snap23 T A 2: 120,586,245 C79S probably damaging Het
Spag6l A C 16: 16,763,020 probably null Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Trav4-3 C A 14: 53,599,139 S20R probably benign Het
Tssk2 G A 16: 17,898,963 E77K probably damaging Het
Ubap2 A G 4: 41,195,482 F1051S probably damaging Het
Ugt3a2 A G 15: 9,367,412 T414A probably benign Het
Urod C T 4: 116,993,404 C66Y probably damaging Het
Vmn1r234 A G 17: 21,229,009 K62E probably damaging Het
Wiz A G 17: 32,359,132 S460P probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb7a C T 10: 81,144,266 T98M probably damaging Het
Zfp524 C A 7: 5,017,885 H137Q probably damaging Het
Other mutations in Rad18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Rad18 APN 6 112665341 splice site probably benign
IGL02425:Rad18 APN 6 112620898 missense probably damaging 1.00
IGL02622:Rad18 APN 6 112687987 missense probably damaging 0.99
IGL02814:Rad18 APN 6 112644622 missense possibly damaging 0.72
3-1:Rad18 UTSW 6 112681511 nonsense probably null
R0823:Rad18 UTSW 6 112665299 missense possibly damaging 0.80
R1220:Rad18 UTSW 6 112649664 nonsense probably null
R1351:Rad18 UTSW 6 112620902 missense possibly damaging 0.55
R1378:Rad18 UTSW 6 112681336 splice site probably benign
R1623:Rad18 UTSW 6 112628519 missense probably damaging 1.00
R1737:Rad18 UTSW 6 112681537 missense probably damaging 1.00
R2509:Rad18 UTSW 6 112675922 missense possibly damaging 0.93
R2893:Rad18 UTSW 6 112675773 nonsense probably null
R2894:Rad18 UTSW 6 112675773 nonsense probably null
R3017:Rad18 UTSW 6 112681366 missense possibly damaging 0.95
R3123:Rad18 UTSW 6 112681346 missense probably benign 0.41
R4392:Rad18 UTSW 6 112693529 missense probably damaging 1.00
R5285:Rad18 UTSW 6 112686765 missense probably benign 0.45
R5566:Rad18 UTSW 6 112681346 missense probably benign 0.41
R5958:Rad18 UTSW 6 112696642 unclassified probably benign
R6744:Rad18 UTSW 6 112675784 missense probably damaging 1.00
R7072:Rad18 UTSW 6 112681440 missense probably benign 0.01
R7247:Rad18 UTSW 6 112665325 missense possibly damaging 0.81
R7860:Rad18 UTSW 6 112649837 missense probably benign 0.01
R7943:Rad18 UTSW 6 112649837 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACCTTGTAAGAAACACAATTGCC -3'
(R):5'- GGGAAGCTTTTCTCAGTCATGATC -3'

Sequencing Primer
(F):5'- TTGCCATATTCAGGAAAAGGTGAC -3'
(R):5'- AAGCTTTTCTCAGTCATGATCCTTTG -3'
Posted On2015-03-18