Incidental Mutation 'R3755:Atf7ip'
ID 271390
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Name activating transcription factor 7 interacting protein
Synonyms ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
MMRRC Submission 040738-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R3755 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 136495787-136587848 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 136537815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 357 (N357K)
Ref Sequence ENSEMBL: ENSMUSP00000140502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335] [ENSMUST00000185724] [ENSMUST00000186577] [ENSMUST00000186742] [ENSMUST00000187429] [ENSMUST00000189535] [ENSMUST00000203988]
AlphaFold Q7TT18
Predicted Effect probably benign
Transcript: ENSMUST00000032335
AA Change: N349K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: N349K

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185724
AA Change: N349K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140458
Gene: ENSMUSG00000030213
AA Change: N349K

DomainStartEndE-ValueType
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186577
SMART Domains Protein: ENSMUSP00000140121
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
coiled coil region 71 101 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186742
Predicted Effect probably benign
Transcript: ENSMUST00000187429
AA Change: N357K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140502
Gene: ENSMUSG00000030213
AA Change: N357K

DomainStartEndE-ValueType
internal_repeat_1 123 144 8.96e-5 PROSPERO
internal_repeat_1 143 164 8.96e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
coiled coil region 666 696 N/A INTRINSIC
low complexity region 701 711 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 774 803 N/A INTRINSIC
low complexity region 864 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189535
Predicted Effect probably benign
Transcript: ENSMUST00000203178
Predicted Effect probably benign
Transcript: ENSMUST00000203988
SMART Domains Protein: ENSMUSP00000145022
Gene: ENSMUSG00000030213

DomainStartEndE-ValueType
Pfam:ATF7IP_BD 3 73 1.6e-26 PFAM
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,098,110 (GRCm39) S169Y probably damaging Het
Abcb1a G A 5: 8,797,403 (GRCm39) V1225M possibly damaging Het
Adamdec1 A T 14: 68,814,587 (GRCm39) I130N probably damaging Het
Bace2 C G 16: 97,237,857 (GRCm39) T436R probably benign Het
Capn13 G A 17: 73,638,114 (GRCm39) Q430* probably null Het
Ccdc30 A T 4: 119,225,005 (GRCm39) probably null Het
Ces5a T C 8: 94,255,130 (GRCm39) T184A probably benign Het
Cntnap5c T C 17: 58,411,594 (GRCm39) C493R possibly damaging Het
Creb3l2 A T 6: 37,340,961 (GRCm39) I146N possibly damaging Het
Erich3 A G 3: 154,469,958 (GRCm39) probably benign Het
Etl4 G A 2: 20,748,348 (GRCm39) V27I probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fsip2 G A 2: 82,808,561 (GRCm39) D1627N probably benign Het
Gcdh A G 8: 85,620,109 (GRCm39) probably benign Het
Kcna7 T C 7: 45,058,369 (GRCm39) F219L probably benign Het
Kdm3b T C 18: 34,941,349 (GRCm39) L280S probably benign Het
Knl1 T A 2: 118,933,060 (GRCm39) V2073D probably damaging Het
Kprp A G 3: 92,732,346 (GRCm39) S235P unknown Het
Lpp A G 16: 24,663,911 (GRCm39) H396R probably benign Het
Lrch4 T A 5: 137,635,992 (GRCm39) D348E probably damaging Het
Mcm9 T C 10: 53,502,048 (GRCm39) N179S probably benign Het
Mettl13 T C 1: 162,371,789 (GRCm39) E360G probably damaging Het
Nfib A T 4: 82,241,936 (GRCm39) S418R probably damaging Het
Or52b1 A G 7: 104,979,358 (GRCm39) F14L probably damaging Het
Or8s2 A C 15: 98,276,463 (GRCm39) I176S probably benign Het
Pcdha8 G A 18: 37,126,741 (GRCm39) V408M probably damaging Het
Pcdhb3 T C 18: 37,435,878 (GRCm39) F615L probably damaging Het
Pkd1l3 C T 8: 110,359,171 (GRCm39) T844I probably damaging Het
Pkhd1l1 A T 15: 44,452,802 (GRCm39) E3909V probably damaging Het
Poldip3 A G 15: 83,015,676 (GRCm39) probably benign Het
Ptpn1 T C 2: 167,816,143 (GRCm39) I219T probably damaging Het
Rad18 T C 6: 112,670,432 (GRCm39) N44S probably damaging Het
Reep5 T C 18: 34,505,527 (GRCm39) Y48C probably damaging Het
Rgl2 C A 17: 34,151,571 (GRCm39) A205D probably benign Het
Rundc3a A G 11: 102,290,085 (GRCm39) I175V possibly damaging Het
Slamf1 C T 1: 171,604,728 (GRCm39) A166V probably damaging Het
Slc4a5 A G 6: 83,265,285 (GRCm39) D693G probably benign Het
Snap23 T A 2: 120,416,726 (GRCm39) C79S probably damaging Het
Spag6l A C 16: 16,580,884 (GRCm39) probably null Het
Trappc13 C T 13: 104,305,068 (GRCm39) D40N probably benign Het
Trav4-3 C A 14: 53,836,596 (GRCm39) S20R probably benign Het
Tssk2 G A 16: 17,716,827 (GRCm39) E77K probably damaging Het
Ubap2 A G 4: 41,195,482 (GRCm39) F1051S probably damaging Het
Ugt3a1 A G 15: 9,367,498 (GRCm39) T414A probably benign Het
Urod C T 4: 116,850,601 (GRCm39) C66Y probably damaging Het
Vmn1r234 A G 17: 21,449,271 (GRCm39) K62E probably damaging Het
Wiz A G 17: 32,578,106 (GRCm39) S460P probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb7a C T 10: 80,980,100 (GRCm39) T98M probably damaging Het
Zfp524 C A 7: 5,020,884 (GRCm39) H137Q probably damaging Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136,537,679 (GRCm39) missense probably benign 0.00
IGL01483:Atf7ip APN 6 136,564,457 (GRCm39) missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136,583,718 (GRCm39) missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136,570,116 (GRCm39) missense probably benign 0.01
IGL02547:Atf7ip APN 6 136,580,274 (GRCm39) splice site probably benign
IGL02869:Atf7ip APN 6 136,583,577 (GRCm39) missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136,537,686 (GRCm39) missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136,583,725 (GRCm39) missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136,582,380 (GRCm39) missense possibly damaging 0.79
fuegado UTSW 6 136,537,708 (GRCm39) missense probably benign
Outtahere UTSW 6 136,542,104 (GRCm39) missense probably damaging 1.00
Severance UTSW 6 136,536,814 (GRCm39) missense probably damaging 1.00
R0024:Atf7ip UTSW 6 136,576,818 (GRCm39) splice site probably benign
R0045:Atf7ip UTSW 6 136,536,814 (GRCm39) missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136,536,814 (GRCm39) missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136,537,987 (GRCm39) missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136,538,161 (GRCm39) missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136,537,010 (GRCm39) missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136,586,190 (GRCm39) unclassified probably benign
R0526:Atf7ip UTSW 6 136,536,803 (GRCm39) missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136,583,865 (GRCm39) missense probably damaging 0.96
R1663:Atf7ip UTSW 6 136,580,322 (GRCm39) missense possibly damaging 0.93
R1793:Atf7ip UTSW 6 136,586,217 (GRCm39) unclassified probably benign
R1822:Atf7ip UTSW 6 136,564,258 (GRCm39) missense probably benign 0.11
R1873:Atf7ip UTSW 6 136,536,886 (GRCm39) missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136,537,778 (GRCm39) missense probably benign 0.41
R2059:Atf7ip UTSW 6 136,586,346 (GRCm39) unclassified probably benign
R2134:Atf7ip UTSW 6 136,582,485 (GRCm39) missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136,543,649 (GRCm39) missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136,552,322 (GRCm39) unclassified probably benign
R3756:Atf7ip UTSW 6 136,537,815 (GRCm39) missense probably benign 0.01
R3890:Atf7ip UTSW 6 136,564,043 (GRCm39) missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136,564,499 (GRCm39) missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136,540,747 (GRCm39) splice site probably null
R4588:Atf7ip UTSW 6 136,576,692 (GRCm39) missense probably benign
R4618:Atf7ip UTSW 6 136,542,104 (GRCm39) missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136,538,192 (GRCm39) missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136,573,489 (GRCm39) missense probably benign 0.06
R4922:Atf7ip UTSW 6 136,537,039 (GRCm39) missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136,583,808 (GRCm39) missense probably damaging 1.00
R4957:Atf7ip UTSW 6 136,583,808 (GRCm39) missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136,583,808 (GRCm39) missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136,559,426 (GRCm39) missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136,538,386 (GRCm39) missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136,537,232 (GRCm39) missense probably benign
R5279:Atf7ip UTSW 6 136,580,377 (GRCm39) nonsense probably null
R5445:Atf7ip UTSW 6 136,564,255 (GRCm39) missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136,583,812 (GRCm39) missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136,543,785 (GRCm39) critical splice donor site probably null
R5891:Atf7ip UTSW 6 136,536,975 (GRCm39) missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136,548,500 (GRCm39) missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136,536,817 (GRCm39) missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136,559,389 (GRCm39) missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136,538,038 (GRCm39) missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136,536,755 (GRCm39) splice site probably null
R7075:Atf7ip UTSW 6 136,573,513 (GRCm39) critical splice donor site probably null
R7308:Atf7ip UTSW 6 136,542,087 (GRCm39) missense probably benign 0.01
R7365:Atf7ip UTSW 6 136,537,708 (GRCm39) missense probably benign
R7556:Atf7ip UTSW 6 136,538,239 (GRCm39) missense probably damaging 0.99
R7812:Atf7ip UTSW 6 136,580,415 (GRCm39) missense probably damaging 0.96
R7973:Atf7ip UTSW 6 136,538,062 (GRCm39) nonsense probably null
R8032:Atf7ip UTSW 6 136,542,110 (GRCm39) missense probably benign 0.00
R8203:Atf7ip UTSW 6 136,583,781 (GRCm39) missense probably damaging 0.99
R8274:Atf7ip UTSW 6 136,537,988 (GRCm39) missense probably benign
R8784:Atf7ip UTSW 6 136,576,648 (GRCm39) missense probably damaging 0.99
R8785:Atf7ip UTSW 6 136,564,162 (GRCm39) missense probably damaging 0.97
R8885:Atf7ip UTSW 6 136,564,141 (GRCm39) missense probably benign 0.06
R8957:Atf7ip UTSW 6 136,543,701 (GRCm39) missense probably null 0.99
R9042:Atf7ip UTSW 6 136,538,263 (GRCm39) nonsense probably null
R9531:Atf7ip UTSW 6 136,537,875 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCACCTTCTAGTGAGGAC -3'
(R):5'- TTCCATGCTGCTGGAGATG -3'

Sequencing Primer
(F):5'- TAGTGAGGACTCCCTTCCTAGG -3'
(R):5'- AGATGGCCTCTTCCTCGAGAG -3'
Posted On 2015-03-18