Incidental Mutation 'R3755:Poldip3'
ID271408
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Namepolymerase (DNA-directed), delta interacting protein 3
Synonyms1110008P04Rik, PDIP46
MMRRC Submission 040738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R3755 (G1)
Quality Score217
Status Validated
Chromosome15
Chromosomal Location83125976-83149384 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 83131475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
Predicted Effect probably benign
Transcript: ENSMUST00000058793
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100375
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129372
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149802
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,222,114 S169Y probably damaging Het
Abcb1a G A 5: 8,747,403 V1225M possibly damaging Het
Adamdec1 A T 14: 68,577,138 I130N probably damaging Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Bace2 C G 16: 97,436,657 T436R probably benign Het
Capn13 G A 17: 73,331,119 Q430* probably null Het
Ccdc30 A T 4: 119,367,808 probably null Het
Ces5a T C 8: 93,528,502 T184A probably benign Het
Cntnap5c T C 17: 58,104,599 C493R possibly damaging Het
Creb3l2 A T 6: 37,364,026 I146N possibly damaging Het
Erich3 A G 3: 154,764,321 probably benign Het
Etl4 G A 2: 20,743,537 V27I probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fsip2 G A 2: 82,978,217 D1627N probably benign Het
Gcdh A G 8: 84,893,480 probably benign Het
Kcna7 T C 7: 45,408,945 F219L probably benign Het
Kdm3b T C 18: 34,808,296 L280S probably benign Het
Knl1 T A 2: 119,102,579 V2073D probably damaging Het
Kprp A G 3: 92,825,039 S235P unknown Het
Lpp A G 16: 24,845,161 H396R probably benign Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mcm9 T C 10: 53,625,952 N179S probably benign Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Nfib A T 4: 82,323,699 S418R probably damaging Het
Olfr283 A C 15: 98,378,582 I176S probably benign Het
Olfr690 A G 7: 105,330,151 F14L probably damaging Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pkd1l3 C T 8: 109,632,539 T844I probably damaging Het
Pkhd1l1 A T 15: 44,589,406 E3909V probably damaging Het
Ptpn1 T C 2: 167,974,223 I219T probably damaging Het
Rad18 T C 6: 112,693,471 N44S probably damaging Het
Reep5 T C 18: 34,372,474 Y48C probably damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Slamf1 C T 1: 171,777,160 A166V probably damaging Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Snap23 T A 2: 120,586,245 C79S probably damaging Het
Spag6l A C 16: 16,763,020 probably null Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Trav4-3 C A 14: 53,599,139 S20R probably benign Het
Tssk2 G A 16: 17,898,963 E77K probably damaging Het
Ubap2 A G 4: 41,195,482 F1051S probably damaging Het
Ugt3a2 A G 15: 9,367,412 T414A probably benign Het
Urod C T 4: 116,993,404 C66Y probably damaging Het
Vmn1r234 A G 17: 21,229,009 K62E probably damaging Het
Wiz A G 17: 32,359,132 S460P probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb7a C T 10: 81,144,266 T98M probably damaging Het
Zfp524 C A 7: 5,017,885 H137Q probably damaging Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83138479 missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83129268 unclassified probably benign
R0143:Poldip3 UTSW 15 83127943 missense probably damaging 1.00
R0201:Poldip3 UTSW 15 83135296 missense probably benign 0.00
R0511:Poldip3 UTSW 15 83138235 missense probably damaging 1.00
R1560:Poldip3 UTSW 15 83138326 missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83129268 unclassified probably benign
R3756:Poldip3 UTSW 15 83131475 unclassified probably benign
R4785:Poldip3 UTSW 15 83131501 missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83132575 critical splice donor site probably null
R4965:Poldip3 UTSW 15 83137505 missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83133194 missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83138191 missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83129229 missense probably damaging 0.96
R6638:Poldip3 UTSW 15 83133200 missense probably damaging 1.00
R7028:Poldip3 UTSW 15 83131497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCAATCGGCTTTCCCAAC -3'
(R):5'- GCAGTGCAGTCTTTGGAGAG -3'

Sequencing Primer
(F):5'- GACCCTTTAAGAGACTCATCCACTG -3'
(R):5'- GGCAAGTGGTCTGCATGTCC -3'
Posted On2015-03-18