Incidental Mutation 'R3755:Bace2'
ID 271415
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 040738-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R3755 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 97237857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Arginine at position 436 (T436R)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000047275
AA Change: T436R

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: T436R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000231892
AA Change: Q40E
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,098,110 (GRCm39) S169Y probably damaging Het
Abcb1a G A 5: 8,797,403 (GRCm39) V1225M possibly damaging Het
Adamdec1 A T 14: 68,814,587 (GRCm39) I130N probably damaging Het
Atf7ip T A 6: 136,537,815 (GRCm39) N357K probably benign Het
Capn13 G A 17: 73,638,114 (GRCm39) Q430* probably null Het
Ccdc30 A T 4: 119,225,005 (GRCm39) probably null Het
Ces5a T C 8: 94,255,130 (GRCm39) T184A probably benign Het
Cntnap5c T C 17: 58,411,594 (GRCm39) C493R possibly damaging Het
Creb3l2 A T 6: 37,340,961 (GRCm39) I146N possibly damaging Het
Erich3 A G 3: 154,469,958 (GRCm39) probably benign Het
Etl4 G A 2: 20,748,348 (GRCm39) V27I probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fsip2 G A 2: 82,808,561 (GRCm39) D1627N probably benign Het
Gcdh A G 8: 85,620,109 (GRCm39) probably benign Het
Kcna7 T C 7: 45,058,369 (GRCm39) F219L probably benign Het
Kdm3b T C 18: 34,941,349 (GRCm39) L280S probably benign Het
Knl1 T A 2: 118,933,060 (GRCm39) V2073D probably damaging Het
Kprp A G 3: 92,732,346 (GRCm39) S235P unknown Het
Lpp A G 16: 24,663,911 (GRCm39) H396R probably benign Het
Lrch4 T A 5: 137,635,992 (GRCm39) D348E probably damaging Het
Mcm9 T C 10: 53,502,048 (GRCm39) N179S probably benign Het
Mettl13 T C 1: 162,371,789 (GRCm39) E360G probably damaging Het
Nfib A T 4: 82,241,936 (GRCm39) S418R probably damaging Het
Or52b1 A G 7: 104,979,358 (GRCm39) F14L probably damaging Het
Or8s2 A C 15: 98,276,463 (GRCm39) I176S probably benign Het
Pcdha8 G A 18: 37,126,741 (GRCm39) V408M probably damaging Het
Pcdhb3 T C 18: 37,435,878 (GRCm39) F615L probably damaging Het
Pkd1l3 C T 8: 110,359,171 (GRCm39) T844I probably damaging Het
Pkhd1l1 A T 15: 44,452,802 (GRCm39) E3909V probably damaging Het
Poldip3 A G 15: 83,015,676 (GRCm39) probably benign Het
Ptpn1 T C 2: 167,816,143 (GRCm39) I219T probably damaging Het
Rad18 T C 6: 112,670,432 (GRCm39) N44S probably damaging Het
Reep5 T C 18: 34,505,527 (GRCm39) Y48C probably damaging Het
Rgl2 C A 17: 34,151,571 (GRCm39) A205D probably benign Het
Rundc3a A G 11: 102,290,085 (GRCm39) I175V possibly damaging Het
Slamf1 C T 1: 171,604,728 (GRCm39) A166V probably damaging Het
Slc4a5 A G 6: 83,265,285 (GRCm39) D693G probably benign Het
Snap23 T A 2: 120,416,726 (GRCm39) C79S probably damaging Het
Spag6l A C 16: 16,580,884 (GRCm39) probably null Het
Trappc13 C T 13: 104,305,068 (GRCm39) D40N probably benign Het
Trav4-3 C A 14: 53,836,596 (GRCm39) S20R probably benign Het
Tssk2 G A 16: 17,716,827 (GRCm39) E77K probably damaging Het
Ubap2 A G 4: 41,195,482 (GRCm39) F1051S probably damaging Het
Ugt3a1 A G 15: 9,367,498 (GRCm39) T414A probably benign Het
Urod C T 4: 116,850,601 (GRCm39) C66Y probably damaging Het
Vmn1r234 A G 17: 21,449,271 (GRCm39) K62E probably damaging Het
Wiz A G 17: 32,578,106 (GRCm39) S460P probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb7a C T 10: 80,980,100 (GRCm39) T98M probably damaging Het
Zfp524 C A 7: 5,020,884 (GRCm39) H137Q probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCACTCCTGAGGGCATG -3'
(R):5'- AGCGATGTCTGACTAGTGAGGAC -3'

Sequencing Primer
(F):5'- GGCATGCTGCTCCTGAG -3'
(R):5'- GGACTCATCGTTAACTACCTCAGGG -3'
Posted On 2015-03-18