Incidental Mutation 'R3755:Rgl2'
ID 271418
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms KE1.5, Rab2l, Rgt2, Rlf
MMRRC Submission 040738-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R3755 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 33929543-33937687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 33932597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 205 (A205D)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: A205D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: A205D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,222,114 S169Y probably damaging Het
Abcb1a G A 5: 8,747,403 V1225M possibly damaging Het
Adamdec1 A T 14: 68,577,138 I130N probably damaging Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Bace2 C G 16: 97,436,657 T436R probably benign Het
Capn13 G A 17: 73,331,119 Q430* probably null Het
Ccdc30 A T 4: 119,367,808 probably null Het
Ces5a T C 8: 93,528,502 T184A probably benign Het
Cntnap5c T C 17: 58,104,599 C493R possibly damaging Het
Creb3l2 A T 6: 37,364,026 I146N possibly damaging Het
Erich3 A G 3: 154,764,321 probably benign Het
Etl4 G A 2: 20,743,537 V27I probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fsip2 G A 2: 82,978,217 D1627N probably benign Het
Gcdh A G 8: 84,893,480 probably benign Het
Kcna7 T C 7: 45,408,945 F219L probably benign Het
Kdm3b T C 18: 34,808,296 L280S probably benign Het
Knl1 T A 2: 119,102,579 V2073D probably damaging Het
Kprp A G 3: 92,825,039 S235P unknown Het
Lpp A G 16: 24,845,161 H396R probably benign Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mcm9 T C 10: 53,625,952 N179S probably benign Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Nfib A T 4: 82,323,699 S418R probably damaging Het
Olfr283 A C 15: 98,378,582 I176S probably benign Het
Olfr690 A G 7: 105,330,151 F14L probably damaging Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pkd1l3 C T 8: 109,632,539 T844I probably damaging Het
Pkhd1l1 A T 15: 44,589,406 E3909V probably damaging Het
Poldip3 A G 15: 83,131,475 probably benign Het
Ptpn1 T C 2: 167,974,223 I219T probably damaging Het
Rad18 T C 6: 112,693,471 N44S probably damaging Het
Reep5 T C 18: 34,372,474 Y48C probably damaging Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Slamf1 C T 1: 171,777,160 A166V probably damaging Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Snap23 T A 2: 120,586,245 C79S probably damaging Het
Spag6l A C 16: 16,763,020 probably null Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Trav4-3 C A 14: 53,599,139 S20R probably benign Het
Tssk2 G A 16: 17,898,963 E77K probably damaging Het
Ubap2 A G 4: 41,195,482 F1051S probably damaging Het
Ugt3a2 A G 15: 9,367,412 T414A probably benign Het
Urod C T 4: 116,993,404 C66Y probably damaging Het
Vmn1r234 A G 17: 21,229,009 K62E probably damaging Het
Wiz A G 17: 32,359,132 S460P probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb7a C T 10: 81,144,266 T98M probably damaging Het
Zfp524 C A 7: 5,017,885 H137Q probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 33933136 missense probably benign 0.31
IGL00898:Rgl2 APN 17 33933418 missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 33935936 missense probably benign 0.00
IGL00985:Rgl2 APN 17 33932101 missense probably damaging 1.00
IGL02140:Rgl2 APN 17 33933124 missense probably damaging 1.00
IGL02214:Rgl2 APN 17 33935189 missense probably benign 0.06
IGL02486:Rgl2 APN 17 33935980 missense probably damaging 0.97
IGL02579:Rgl2 APN 17 33937160 missense probably benign 0.08
IGL02976:Rgl2 APN 17 33933962 missense possibly damaging 0.95
Hypotenuse UTSW 17 33931739 missense probably benign 0.00
Pedernales UTSW 17 33932038 critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 33933940 missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 33932738 missense probably damaging 1.00
R0456:Rgl2 UTSW 17 33936849 splice site probably null
R0825:Rgl2 UTSW 17 33935159 splice site probably null
R1742:Rgl2 UTSW 17 33937223 splice site probably null
R1777:Rgl2 UTSW 17 33931744 missense probably benign 0.00
R1829:Rgl2 UTSW 17 33933621 missense probably benign 0.00
R1908:Rgl2 UTSW 17 33932148 missense probably benign 0.00
R1961:Rgl2 UTSW 17 33933615 missense probably damaging 1.00
R2102:Rgl2 UTSW 17 33933340 splice site probably null
R3001:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3002:Rgl2 UTSW 17 33932605 missense probably benign 0.00
R3756:Rgl2 UTSW 17 33932597 missense probably benign 0.01
R3978:Rgl2 UTSW 17 33935162 missense probably benign 0.02
R4042:Rgl2 UTSW 17 33937262 missense probably damaging 1.00
R4064:Rgl2 UTSW 17 33937108 missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 33936932 missense probably benign 0.04
R4661:Rgl2 UTSW 17 33933226 missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 33937173 missense probably benign 0.00
R4922:Rgl2 UTSW 17 33932775 unclassified probably benign
R5119:Rgl2 UTSW 17 33937120 missense probably benign 0.00
R5167:Rgl2 UTSW 17 33935974 nonsense probably null
R5279:Rgl2 UTSW 17 33935948 missense probably benign
R5319:Rgl2 UTSW 17 33933555 missense probably benign 0.02
R5337:Rgl2 UTSW 17 33934984 missense probably damaging 0.99
R5881:Rgl2 UTSW 17 33932717 missense probably benign 0.01
R5945:Rgl2 UTSW 17 33932038 critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 33931765 missense probably benign 0.01
R6358:Rgl2 UTSW 17 33937131 splice site probably null
R6867:Rgl2 UTSW 17 33932687 missense probably benign 0.09
R7174:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7203:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7250:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7253:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 33934990 missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 33933429 missense probably damaging 1.00
R7455:Rgl2 UTSW 17 33932683 missense probably benign 0.32
R7513:Rgl2 UTSW 17 33932555 missense probably benign
R7752:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 33935825 missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 33931739 missense probably benign 0.00
R8158:Rgl2 UTSW 17 33936944 missense probably benign 0.27
R8209:Rgl2 UTSW 17 33932527 missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 33932527 missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 33933724 nonsense probably null
R8871:Rgl2 UTSW 17 33935000 missense probably damaging 1.00
R9205:Rgl2 UTSW 17 33936028 missense probably damaging 1.00
R9591:Rgl2 UTSW 17 33932477 missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 33932458 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCTCATCCTCCCGGTGAG -3'
(R):5'- CAAAGGTCAAGGTCTCACCG -3'

Sequencing Primer
(F):5'- TGAGTGGCCCTGTCTGAAC -3'
(R):5'- GTCAAGGTCTCACCGCATCTAG -3'
Posted On 2015-03-18