Incidental Mutation 'R3755:Rgl2'
ID 271418
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 040738-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R3755 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34151571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 205 (A205D)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
AA Change: A205D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: A205D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,098,110 (GRCm39) S169Y probably damaging Het
Abcb1a G A 5: 8,797,403 (GRCm39) V1225M possibly damaging Het
Adamdec1 A T 14: 68,814,587 (GRCm39) I130N probably damaging Het
Atf7ip T A 6: 136,537,815 (GRCm39) N357K probably benign Het
Bace2 C G 16: 97,237,857 (GRCm39) T436R probably benign Het
Capn13 G A 17: 73,638,114 (GRCm39) Q430* probably null Het
Ccdc30 A T 4: 119,225,005 (GRCm39) probably null Het
Ces5a T C 8: 94,255,130 (GRCm39) T184A probably benign Het
Cntnap5c T C 17: 58,411,594 (GRCm39) C493R possibly damaging Het
Creb3l2 A T 6: 37,340,961 (GRCm39) I146N possibly damaging Het
Erich3 A G 3: 154,469,958 (GRCm39) probably benign Het
Etl4 G A 2: 20,748,348 (GRCm39) V27I probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fsip2 G A 2: 82,808,561 (GRCm39) D1627N probably benign Het
Gcdh A G 8: 85,620,109 (GRCm39) probably benign Het
Kcna7 T C 7: 45,058,369 (GRCm39) F219L probably benign Het
Kdm3b T C 18: 34,941,349 (GRCm39) L280S probably benign Het
Knl1 T A 2: 118,933,060 (GRCm39) V2073D probably damaging Het
Kprp A G 3: 92,732,346 (GRCm39) S235P unknown Het
Lpp A G 16: 24,663,911 (GRCm39) H396R probably benign Het
Lrch4 T A 5: 137,635,992 (GRCm39) D348E probably damaging Het
Mcm9 T C 10: 53,502,048 (GRCm39) N179S probably benign Het
Mettl13 T C 1: 162,371,789 (GRCm39) E360G probably damaging Het
Nfib A T 4: 82,241,936 (GRCm39) S418R probably damaging Het
Or52b1 A G 7: 104,979,358 (GRCm39) F14L probably damaging Het
Or8s2 A C 15: 98,276,463 (GRCm39) I176S probably benign Het
Pcdha8 G A 18: 37,126,741 (GRCm39) V408M probably damaging Het
Pcdhb3 T C 18: 37,435,878 (GRCm39) F615L probably damaging Het
Pkd1l3 C T 8: 110,359,171 (GRCm39) T844I probably damaging Het
Pkhd1l1 A T 15: 44,452,802 (GRCm39) E3909V probably damaging Het
Poldip3 A G 15: 83,015,676 (GRCm39) probably benign Het
Ptpn1 T C 2: 167,816,143 (GRCm39) I219T probably damaging Het
Rad18 T C 6: 112,670,432 (GRCm39) N44S probably damaging Het
Reep5 T C 18: 34,505,527 (GRCm39) Y48C probably damaging Het
Rundc3a A G 11: 102,290,085 (GRCm39) I175V possibly damaging Het
Slamf1 C T 1: 171,604,728 (GRCm39) A166V probably damaging Het
Slc4a5 A G 6: 83,265,285 (GRCm39) D693G probably benign Het
Snap23 T A 2: 120,416,726 (GRCm39) C79S probably damaging Het
Spag6l A C 16: 16,580,884 (GRCm39) probably null Het
Trappc13 C T 13: 104,305,068 (GRCm39) D40N probably benign Het
Trav4-3 C A 14: 53,836,596 (GRCm39) S20R probably benign Het
Tssk2 G A 16: 17,716,827 (GRCm39) E77K probably damaging Het
Ubap2 A G 4: 41,195,482 (GRCm39) F1051S probably damaging Het
Ugt3a1 A G 15: 9,367,498 (GRCm39) T414A probably benign Het
Urod C T 4: 116,850,601 (GRCm39) C66Y probably damaging Het
Vmn1r234 A G 17: 21,449,271 (GRCm39) K62E probably damaging Het
Wiz A G 17: 32,578,106 (GRCm39) S460P probably damaging Het
Zbbx C T 3: 75,012,978 (GRCm39) G151E probably damaging Het
Zbtb7a C T 10: 80,980,100 (GRCm39) T98M probably damaging Het
Zfp524 C A 7: 5,020,884 (GRCm39) H137Q probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCTCATCCTCCCGGTGAG -3'
(R):5'- CAAAGGTCAAGGTCTCACCG -3'

Sequencing Primer
(F):5'- TGAGTGGCCCTGTCTGAAC -3'
(R):5'- GTCAAGGTCTCACCGCATCTAG -3'
Posted On 2015-03-18