Incidental Mutation 'R3755:Pcdhb3'
ID271423
Institutional Source Beutler Lab
Gene Symbol Pcdhb3
Ensembl Gene ENSMUSG00000045498
Gene Nameprotocadherin beta 3
SynonymsPcdhbC
MMRRC Submission 040738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3755 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37300799-37304585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37302825 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 615 (F615L)
Ref Sequence ENSEMBL: ENSMUSP00000059180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000051754
AA Change: F615L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498
AA Change: F615L

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056712
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.3608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik C A 10: 29,222,114 S169Y probably damaging Het
Abcb1a G A 5: 8,747,403 V1225M possibly damaging Het
Adamdec1 A T 14: 68,577,138 I130N probably damaging Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Bace2 C G 16: 97,436,657 T436R probably benign Het
Capn13 G A 17: 73,331,119 Q430* probably null Het
Ccdc30 A T 4: 119,367,808 probably null Het
Ces5a T C 8: 93,528,502 T184A probably benign Het
Cntnap5c T C 17: 58,104,599 C493R possibly damaging Het
Creb3l2 A T 6: 37,364,026 I146N possibly damaging Het
Erich3 A G 3: 154,764,321 probably benign Het
Etl4 G A 2: 20,743,537 V27I probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fsip2 G A 2: 82,978,217 D1627N probably benign Het
Gcdh A G 8: 84,893,480 probably benign Het
Kcna7 T C 7: 45,408,945 F219L probably benign Het
Kdm3b T C 18: 34,808,296 L280S probably benign Het
Knl1 T A 2: 119,102,579 V2073D probably damaging Het
Kprp A G 3: 92,825,039 S235P unknown Het
Lpp A G 16: 24,845,161 H396R probably benign Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mcm9 T C 10: 53,625,952 N179S probably benign Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Nfib A T 4: 82,323,699 S418R probably damaging Het
Olfr283 A C 15: 98,378,582 I176S probably benign Het
Olfr690 A G 7: 105,330,151 F14L probably damaging Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pkd1l3 C T 8: 109,632,539 T844I probably damaging Het
Pkhd1l1 A T 15: 44,589,406 E3909V probably damaging Het
Poldip3 A G 15: 83,131,475 probably benign Het
Ptpn1 T C 2: 167,974,223 I219T probably damaging Het
Rad18 T C 6: 112,693,471 N44S probably damaging Het
Reep5 T C 18: 34,372,474 Y48C probably damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Slamf1 C T 1: 171,777,160 A166V probably damaging Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Snap23 T A 2: 120,586,245 C79S probably damaging Het
Spag6l A C 16: 16,763,020 probably null Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Trav4-3 C A 14: 53,599,139 S20R probably benign Het
Tssk2 G A 16: 17,898,963 E77K probably damaging Het
Ubap2 A G 4: 41,195,482 F1051S probably damaging Het
Ugt3a2 A G 15: 9,367,412 T414A probably benign Het
Urod C T 4: 116,993,404 C66Y probably damaging Het
Vmn1r234 A G 17: 21,229,009 K62E probably damaging Het
Wiz A G 17: 32,359,132 S460P probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zbtb7a C T 10: 81,144,266 T98M probably damaging Het
Zfp524 C A 7: 5,017,885 H137Q probably damaging Het
Other mutations in Pcdhb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Pcdhb3 APN 18 37302948 missense probably benign 0.12
IGL01568:Pcdhb3 APN 18 37302001 missense possibly damaging 0.74
IGL02541:Pcdhb3 APN 18 37302145 missense probably damaging 0.99
IGL02852:Pcdhb3 APN 18 37302097 missense probably damaging 1.00
IGL03140:Pcdhb3 APN 18 37301219 missense probably benign 0.00
IGL03336:Pcdhb3 APN 18 37302961 missense possibly damaging 0.86
R0380:Pcdhb3 UTSW 18 37302157 missense possibly damaging 0.48
R1558:Pcdhb3 UTSW 18 37301581 missense probably damaging 1.00
R1713:Pcdhb3 UTSW 18 37303322 missense probably benign
R1728:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1784:Pcdhb3 UTSW 18 37301878 missense probably damaging 1.00
R1838:Pcdhb3 UTSW 18 37301317 missense probably benign 0.00
R2079:Pcdhb3 UTSW 18 37303309 missense possibly damaging 0.93
R2164:Pcdhb3 UTSW 18 37302186 missense possibly damaging 0.78
R2513:Pcdhb3 UTSW 18 37301239 nonsense probably null
R2513:Pcdhb3 UTSW 18 37301240 missense probably damaging 1.00
R2513:Pcdhb3 UTSW 18 37301241 missense probably benign 0.17
R3080:Pcdhb3 UTSW 18 37301482 missense probably damaging 1.00
R3756:Pcdhb3 UTSW 18 37302825 missense probably damaging 0.97
R3862:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3863:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R3864:Pcdhb3 UTSW 18 37303276 missense probably damaging 1.00
R4114:Pcdhb3 UTSW 18 37302040 missense probably benign 0.03
R4895:Pcdhb3 UTSW 18 37301706 missense probably damaging 1.00
R4917:Pcdhb3 UTSW 18 37302399 missense probably damaging 0.99
R5508:Pcdhb3 UTSW 18 37301126 missense probably damaging 1.00
R5779:Pcdhb3 UTSW 18 37301467 missense probably benign 0.26
R5848:Pcdhb3 UTSW 18 37301647 missense probably benign 0.39
R5991:Pcdhb3 UTSW 18 37301508 missense probably benign 0.07
R6014:Pcdhb3 UTSW 18 37302653 missense probably damaging 1.00
R6111:Pcdhb3 UTSW 18 37302189 missense probably benign 0.00
R6282:Pcdhb3 UTSW 18 37301646 missense probably damaging 1.00
R6339:Pcdhb3 UTSW 18 37300945 intron probably benign
R6425:Pcdhb3 UTSW 18 37302475 missense possibly damaging 0.64
R6860:Pcdhb3 UTSW 18 37301710 missense probably benign 0.01
R6896:Pcdhb3 UTSW 18 37301212 missense probably damaging 1.00
R6946:Pcdhb3 UTSW 18 37302619 missense probably damaging 1.00
R7110:Pcdhb3 UTSW 18 37302922 missense possibly damaging 0.87
R7236:Pcdhb3 UTSW 18 37301452 missense probably damaging 1.00
R7402:Pcdhb3 UTSW 18 37301604 missense probably benign
R7469:Pcdhb3 UTSW 18 37301335 missense probably benign 0.02
R7723:Pcdhb3 UTSW 18 37302512 missense probably damaging 0.98
R7738:Pcdhb3 UTSW 18 37302959 missense probably benign 0.00
R7800:Pcdhb3 UTSW 18 37301921 missense probably benign 0.00
R7817:Pcdhb3 UTSW 18 37302929 missense probably benign
X0026:Pcdhb3 UTSW 18 37301764 missense probably damaging 0.96
X0066:Pcdhb3 UTSW 18 37302339 nonsense probably null
Z1177:Pcdhb3 UTSW 18 37302036 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAATGACAATGCGCCCTTCG -3'
(R):5'- GAGCAAGTCCACGTCGTTTTG -3'

Sequencing Primer
(F):5'- TTCGTGCTCTACCCACTACAGAAC -3'
(R):5'- CACCTCAGGCAAAGGCAGG -3'
Posted On2015-03-18