Incidental Mutation 'R3756:Mtss1l'
ID271442
Institutional Source Beutler Lab
Gene Symbol Mtss1l
Ensembl Gene ENSMUSG00000033763
Gene Namemetastasis suppressor 1-like
SynonymsABBA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3756 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location110721476-110741400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110730060 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 192 (S192L)
Ref Sequence ENSEMBL: ENSMUSP00000115220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052457] [ENSMUST00000144041]
Predicted Effect probably damaging
Transcript: ENSMUST00000052457
AA Change: S254L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050211
Gene: ENSMUSG00000033763
AA Change: S254L

DomainStartEndE-ValueType
Pfam:IMD 15 236 8.1e-108 PFAM
low complexity region 252 274 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 312 330 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
low complexity region 668 690 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141302
AA Change: S139L
SMART Domains Protein: ENSMUSP00000116518
Gene: ENSMUSG00000033763
AA Change: S139L

DomainStartEndE-ValueType
Pfam:IMD 1 122 1e-56 PFAM
low complexity region 138 179 N/A INTRINSIC
low complexity region 202 213 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 286 304 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141527
Predicted Effect probably damaging
Transcript: ENSMUST00000144041
AA Change: S192L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115220
Gene: ENSMUSG00000033763
AA Change: S192L

DomainStartEndE-ValueType
Pfam:IMD 1 174 3.6e-72 PFAM
low complexity region 190 212 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 306 324 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149273
AA Change: S143L
SMART Domains Protein: ENSMUSP00000119495
Gene: ENSMUSG00000033763
AA Change: S143L

DomainStartEndE-ValueType
Pfam:IMD 1 126 2.5e-59 PFAM
low complexity region 142 183 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad2 A G 15: 58,099,723 C805R probably benign Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Atp7a T A X: 106,101,843 probably null Het
Cdc16 T C 8: 13,777,609 probably null Het
Cdh26 T A 2: 178,470,001 probably benign Het
Ctdp1 A T 18: 80,452,351 S273T probably damaging Het
Cyb5d1 G T 11: 69,393,832 R165S probably damaging Het
Ddhd1 T C 14: 45,610,573 K546R probably benign Het
Ddhd1 A T 14: 45,657,263 V250E probably damaging Het
Dnm1l G T 16: 16,321,612 A406D possibly damaging Het
Efs G A 14: 54,920,422 probably benign Het
Ephb1 A C 9: 102,041,039 S424A probably benign Het
Erich3 A G 3: 154,764,321 probably benign Het
Erich3 A G 3: 154,764,578 T83A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm9970 G C 5: 31,240,773 probably benign Het
H2afv A G 11: 6,433,761 V53A possibly damaging Het
Inpp5d G A 1: 87,701,408 probably benign Het
Lhcgr A G 17: 88,753,856 S256P possibly damaging Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Myh8 G A 11: 67,284,617 probably benign Het
Myom2 T A 8: 15,102,650 Y666N probably benign Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pitrm1 T C 13: 6,558,235 L333P probably damaging Het
Plxnb1 G T 9: 109,113,458 probably benign Het
Poldip3 A G 15: 83,131,475 probably benign Het
Rbmx2 T A X: 48,709,013 S143T possibly damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Rxra A C 2: 27,741,911 Q198P probably damaging Het
Slc25a36 A T 9: 97,100,155 Y42* probably null Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Tmem86b A G 7: 4,628,624 L138P probably damaging Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Vmn1r39 T C 6: 66,804,879 S152G probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp35 T C 18: 24,002,925 C109R possibly damaging Het
Other mutations in Mtss1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02124:Mtss1l APN 8 110737624 missense probably damaging 1.00
R0620:Mtss1l UTSW 8 110737948 missense probably damaging 0.98
R0685:Mtss1l UTSW 8 110727397 critical splice donor site probably null
R2082:Mtss1l UTSW 8 110726257 critical splice donor site probably null
R2149:Mtss1l UTSW 8 110726383 missense possibly damaging 0.58
R2266:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2267:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2269:Mtss1l UTSW 8 110728730 missense possibly damaging 0.80
R2378:Mtss1l UTSW 8 110738349 missense probably damaging 1.00
R4005:Mtss1l UTSW 8 110739041 frame shift probably null
R4552:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4553:Mtss1l UTSW 8 110738505 missense probably damaging 1.00
R4849:Mtss1l UTSW 8 110726243 missense possibly damaging 0.92
R5212:Mtss1l UTSW 8 110729218 missense probably damaging 1.00
R6294:Mtss1l UTSW 8 110727328 missense possibly damaging 0.89
R6336:Mtss1l UTSW 8 110732164 missense probably damaging 1.00
R7090:Mtss1l UTSW 8 110730024 missense probably damaging 1.00
R7580:Mtss1l UTSW 8 110737636 missense possibly damaging 0.95
R7581:Mtss1l UTSW 8 110726213 missense possibly damaging 0.92
R7810:Mtss1l UTSW 8 110726201 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAGGTTCATCTCCTGAGG -3'
(R):5'- TCTCCTGCCAACCAATGTGTG -3'

Sequencing Primer
(F):5'- CCTGAGGTTTAGTTCACCACTGG -3'
(R):5'- CACCCGTATCTCCTATATGTGAGAAG -3'
Posted On2015-03-18