Incidental Mutation 'R3756:Cyb5d1'
ID271448
Institutional Source Beutler Lab
Gene Symbol Cyb5d1
Ensembl Gene ENSMUSG00000044795
Gene Namecytochrome b5 domain containing 1
SynonymsLOC327951
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3756 (G1)
Quality Score155
Status Validated
Chromosome11
Chromosomal Location69391925-69395631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69393832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 165 (R165S)
Ref Sequence ENSEMBL: ENSMUSP00000059709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050140] [ENSMUST00000051620] [ENSMUST00000094077] [ENSMUST00000108660] [ENSMUST00000144531]
Predicted Effect probably benign
Transcript: ENSMUST00000050140
SMART Domains Protein: ENSMUSP00000055528
Gene: ENSMUSG00000045377

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051620
AA Change: R165S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059709
Gene: ENSMUSG00000044795
AA Change: R165S

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082283
Predicted Effect probably benign
Transcript: ENSMUST00000094077
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108660
SMART Domains Protein: ENSMUSP00000104300
Gene: ENSMUSG00000044795

DomainStartEndE-ValueType
Cyt-b5 20 92 1.89e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142126
Predicted Effect probably benign
Transcript: ENSMUST00000144531
SMART Domains Protein: ENSMUSP00000123155
Gene: ENSMUSG00000059278

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Sm 43 114 4.26e-15 SMART
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad2 A G 15: 58,099,723 C805R probably benign Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Atp7a T A X: 106,101,843 probably null Het
Cdc16 T C 8: 13,777,609 probably null Het
Cdh26 T A 2: 178,470,001 probably benign Het
Ctdp1 A T 18: 80,452,351 S273T probably damaging Het
Ddhd1 T C 14: 45,610,573 K546R probably benign Het
Ddhd1 A T 14: 45,657,263 V250E probably damaging Het
Dnm1l G T 16: 16,321,612 A406D possibly damaging Het
Efs G A 14: 54,920,422 probably benign Het
Ephb1 A C 9: 102,041,039 S424A probably benign Het
Erich3 A G 3: 154,764,321 probably benign Het
Erich3 A G 3: 154,764,578 T83A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm9970 G C 5: 31,240,773 probably benign Het
H2afv A G 11: 6,433,761 V53A possibly damaging Het
Inpp5d G A 1: 87,701,408 probably benign Het
Lhcgr A G 17: 88,753,856 S256P possibly damaging Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Mtss1l C T 8: 110,730,060 S192L probably damaging Het
Myh8 G A 11: 67,284,617 probably benign Het
Myom2 T A 8: 15,102,650 Y666N probably benign Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pitrm1 T C 13: 6,558,235 L333P probably damaging Het
Plxnb1 G T 9: 109,113,458 probably benign Het
Poldip3 A G 15: 83,131,475 probably benign Het
Rbmx2 T A X: 48,709,013 S143T possibly damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Rxra A C 2: 27,741,911 Q198P probably damaging Het
Slc25a36 A T 9: 97,100,155 Y42* probably null Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Tmem86b A G 7: 4,628,624 L138P probably damaging Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Vmn1r39 T C 6: 66,804,879 S152G probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp35 T C 18: 24,002,925 C109R possibly damaging Het
Other mutations in Cyb5d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Cyb5d1 APN 11 69393784 unclassified probably null
IGL01897:Cyb5d1 APN 11 69393761 missense probably benign
IGL02566:Cyb5d1 APN 11 69393768 missense probably benign 0.01
IGL02732:Cyb5d1 APN 11 69393809 splice site probably null
R0025:Cyb5d1 UTSW 11 69394966 splice site probably null
R0760:Cyb5d1 UTSW 11 69395173 missense probably benign
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1195:Cyb5d1 UTSW 11 69394971 critical splice donor site probably null
R1907:Cyb5d1 UTSW 11 69394740 missense probably benign 0.32
R2220:Cyb5d1 UTSW 11 69395045 missense probably benign 0.00
R4757:Cyb5d1 UTSW 11 69394988 missense probably damaging 0.99
R4994:Cyb5d1 UTSW 11 69393771 missense probably damaging 1.00
R5509:Cyb5d1 UTSW 11 69393735 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GCTCTGTGAGGTCATCATTGAAG -3'
(R):5'- CAAGCTCTGTCATTTCTGGTG -3'

Sequencing Primer
(F):5'- CTGTGAGGTCATCATTGAAGTAGAGC -3'
(R):5'- CTGGGAATTGAACTCAGGACCTTC -3'
Posted On2015-03-18