Incidental Mutation 'R3756:Poldip3'
ID271456
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Namepolymerase (DNA-directed), delta interacting protein 3
Synonyms1110008P04Rik, PDIP46
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3756 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83125976-83149384 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 83131475 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
Predicted Effect probably benign
Transcript: ENSMUST00000058793
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100375
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129372
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149802
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad2 A G 15: 58,099,723 C805R probably benign Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Atp7a T A X: 106,101,843 probably null Het
Cdc16 T C 8: 13,777,609 probably null Het
Cdh26 T A 2: 178,470,001 probably benign Het
Ctdp1 A T 18: 80,452,351 S273T probably damaging Het
Cyb5d1 G T 11: 69,393,832 R165S probably damaging Het
Ddhd1 T C 14: 45,610,573 K546R probably benign Het
Ddhd1 A T 14: 45,657,263 V250E probably damaging Het
Dnm1l G T 16: 16,321,612 A406D possibly damaging Het
Efs G A 14: 54,920,422 probably benign Het
Ephb1 A C 9: 102,041,039 S424A probably benign Het
Erich3 A G 3: 154,764,321 probably benign Het
Erich3 A G 3: 154,764,578 T83A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm9970 G C 5: 31,240,773 probably benign Het
H2afv A G 11: 6,433,761 V53A possibly damaging Het
Inpp5d G A 1: 87,701,408 probably benign Het
Lhcgr A G 17: 88,753,856 S256P possibly damaging Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Mtss1l C T 8: 110,730,060 S192L probably damaging Het
Myh8 G A 11: 67,284,617 probably benign Het
Myom2 T A 8: 15,102,650 Y666N probably benign Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pitrm1 T C 13: 6,558,235 L333P probably damaging Het
Plxnb1 G T 9: 109,113,458 probably benign Het
Rbmx2 T A X: 48,709,013 S143T possibly damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Rxra A C 2: 27,741,911 Q198P probably damaging Het
Slc25a36 A T 9: 97,100,155 Y42* probably null Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Tmem86b A G 7: 4,628,624 L138P probably damaging Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Vmn1r39 T C 6: 66,804,879 S152G probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp35 T C 18: 24,002,925 C109R possibly damaging Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83138479 missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83129268 unclassified probably benign
R0143:Poldip3 UTSW 15 83127943 missense probably damaging 1.00
R0201:Poldip3 UTSW 15 83135296 missense probably benign 0.00
R0511:Poldip3 UTSW 15 83138235 missense probably damaging 1.00
R1560:Poldip3 UTSW 15 83138326 missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83129268 unclassified probably benign
R3755:Poldip3 UTSW 15 83131475 unclassified probably benign
R4785:Poldip3 UTSW 15 83131501 missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83132575 critical splice donor site probably null
R4965:Poldip3 UTSW 15 83137505 missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83133194 missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83138191 missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83129229 missense probably damaging 0.96
R6638:Poldip3 UTSW 15 83133200 missense probably damaging 1.00
R7028:Poldip3 UTSW 15 83131497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCAACCAGACCCTTTAAG -3'
(R):5'- GCAGTGCAGTCTTTGGAGAG -3'

Sequencing Primer
(F):5'- GACCCTTTAAGAGACTCATCCACTG -3'
(R):5'- GGCAAGTGGTCTGCATGTCC -3'
Posted On2015-03-18