Incidental Mutation 'R3756:Dnm1l'
ID271457
Institutional Source Beutler Lab
Gene Symbol Dnm1l
Ensembl Gene ENSMUSG00000022789
Gene Namedynamin 1-like
Synonyms6330417M19Rik, python, Dnmlp1, Drp1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3756 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16312230-16358959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16321612 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 406 (A406D)
Ref Sequence ENSEMBL: ENSMUSP00000155429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023477] [ENSMUST00000096229] [ENSMUST00000115749] [ENSMUST00000230022] [ENSMUST00000230980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023477
AA Change: A504D

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023477
Gene: ENSMUSG00000022789
AA Change: A504D

DomainStartEndE-ValueType
DYNc 1 255 9.83e-124 SMART
low complexity region 556 571 N/A INTRINSIC
GED 602 693 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096229
AA Change: A517D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000093945
Gene: ENSMUSG00000022789
AA Change: A517D

DomainStartEndE-ValueType
DYNc 1 268 1.75e-120 SMART
low complexity region 569 584 N/A INTRINSIC
GED 615 706 2.52e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115749
AA Change: A355D

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111415
Gene: ENSMUSG00000022789
AA Change: A355D

DomainStartEndE-ValueType
DYNc 1 261 2.08e-122 SMART
low complexity region 573 588 N/A INTRINSIC
GED 619 710 2.52e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000230022
AA Change: A406D

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230958
Predicted Effect probably benign
Transcript: ENSMUST00000230980
AA Change: A510D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.2086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family. The encoded protein is localized to the cytoplasm and mitochondrial membrane, is involved in mitochondrial and peroxisomal division, and is essential for mitochondrial fission. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E11.5 with internal hemorrhage and small size. Mice heterozygous for an ENU induced allele have dilated cardiomyopathy and congestive heart failure, homozygous are embryonic lethal with posterior truncation at E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad2 A G 15: 58,099,723 C805R probably benign Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Atp7a T A X: 106,101,843 probably null Het
Cdc16 T C 8: 13,777,609 probably null Het
Cdh26 T A 2: 178,470,001 probably benign Het
Ctdp1 A T 18: 80,452,351 S273T probably damaging Het
Cyb5d1 G T 11: 69,393,832 R165S probably damaging Het
Ddhd1 T C 14: 45,610,573 K546R probably benign Het
Ddhd1 A T 14: 45,657,263 V250E probably damaging Het
Efs G A 14: 54,920,422 probably benign Het
Ephb1 A C 9: 102,041,039 S424A probably benign Het
Erich3 A G 3: 154,764,321 probably benign Het
Erich3 A G 3: 154,764,578 T83A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm9970 G C 5: 31,240,773 probably benign Het
H2afv A G 11: 6,433,761 V53A possibly damaging Het
Inpp5d G A 1: 87,701,408 probably benign Het
Lhcgr A G 17: 88,753,856 S256P possibly damaging Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Mtss1l C T 8: 110,730,060 S192L probably damaging Het
Myh8 G A 11: 67,284,617 probably benign Het
Myom2 T A 8: 15,102,650 Y666N probably benign Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pitrm1 T C 13: 6,558,235 L333P probably damaging Het
Plxnb1 G T 9: 109,113,458 probably benign Het
Poldip3 A G 15: 83,131,475 probably benign Het
Rbmx2 T A X: 48,709,013 S143T possibly damaging Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Rxra A C 2: 27,741,911 Q198P probably damaging Het
Slc25a36 A T 9: 97,100,155 Y42* probably null Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Tmem86b A G 7: 4,628,624 L138P probably damaging Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Vmn1r39 T C 6: 66,804,879 S152G probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp35 T C 18: 24,002,925 C109R possibly damaging Het
Other mutations in Dnm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Dnm1l APN 16 16333827 critical splice donor site probably null
IGL00696:Dnm1l APN 16 16342715 missense probably benign
IGL01146:Dnm1l APN 16 16314325 missense probably benign 0.01
IGL01385:Dnm1l APN 16 16341453 missense probably damaging 1.00
IGL01694:Dnm1l APN 16 16316651 missense probably benign 0.08
IGL02250:Dnm1l APN 16 16321686 splice site probably benign
IGL02335:Dnm1l APN 16 16342740 intron probably benign
IGL02345:Dnm1l APN 16 16329894 missense possibly damaging 0.61
IGL02403:Dnm1l APN 16 16336976 missense possibly damaging 0.78
IGL02684:Dnm1l APN 16 16321657 missense possibly damaging 0.95
IGL02869:Dnm1l APN 16 16341424 nonsense probably null
IGL03388:Dnm1l APN 16 16314052 splice site probably benign
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R1259:Dnm1l UTSW 16 16324006 missense possibly damaging 0.67
R1554:Dnm1l UTSW 16 16341426 missense probably benign 0.13
R1756:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R1913:Dnm1l UTSW 16 16329966 missense probably benign 0.45
R2906:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R2907:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R4226:Dnm1l UTSW 16 16314387 missense possibly damaging 0.80
R4414:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R5287:Dnm1l UTSW 16 16333868 missense probably damaging 1.00
R5574:Dnm1l UTSW 16 16329821 missense probably damaging 1.00
R5653:Dnm1l UTSW 16 16319489 missense probably damaging 1.00
R6113:Dnm1l UTSW 16 16341003 missense probably benign 0.00
R6320:Dnm1l UTSW 16 16332088 missense probably damaging 1.00
R6644:Dnm1l UTSW 16 16329873 missense probably benign 0.14
R6995:Dnm1l UTSW 16 16329807 nonsense probably null
R7309:Dnm1l UTSW 16 16321646 missense probably damaging 1.00
R7422:Dnm1l UTSW 16 16318474 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGTCCCAGGTGACTCTGAGATC -3'
(R):5'- CCTAACTACCTCAGGCTTAAATACG -3'

Sequencing Primer
(F):5'- CCAGCAGTAATATGCCAC -3'
(R):5'- GGTGCATAACTTAGTGGCA -3'
Posted On2015-03-18