Incidental Mutation 'R3756:Rbmx2'
ID271463
Institutional Source Beutler Lab
Gene Symbol Rbmx2
Ensembl Gene ENSMUSG00000031107
Gene NameRNA binding motif protein, X-linked 2
Synonyms2810411A03Rik, 2700089A17Rik, CGI-79
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R3756 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location48695004-48710723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48709013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 143 (S143T)
Ref Sequence ENSEMBL: ENSMUSP00000033433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033433
AA Change: S143T

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033433
Gene: ENSMUSG00000031107
AA Change: S143T

DomainStartEndE-ValueType
RRM 37 110 6.15e-24 SMART
coiled coil region 152 181 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 255 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139150
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atad2 A G 15: 58,099,723 C805R probably benign Het
Atf7ip T A 6: 136,560,817 N357K probably benign Het
Atp7a T A X: 106,101,843 probably null Het
Cdc16 T C 8: 13,777,609 probably null Het
Cdh26 T A 2: 178,470,001 probably benign Het
Ctdp1 A T 18: 80,452,351 S273T probably damaging Het
Cyb5d1 G T 11: 69,393,832 R165S probably damaging Het
Ddhd1 T C 14: 45,610,573 K546R probably benign Het
Ddhd1 A T 14: 45,657,263 V250E probably damaging Het
Dnm1l G T 16: 16,321,612 A406D possibly damaging Het
Efs G A 14: 54,920,422 probably benign Het
Ephb1 A C 9: 102,041,039 S424A probably benign Het
Erich3 A G 3: 154,764,321 probably benign Het
Erich3 A G 3: 154,764,578 T83A possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gm9970 G C 5: 31,240,773 probably benign Het
H2afv A G 11: 6,433,761 V53A possibly damaging Het
Inpp5d G A 1: 87,701,408 probably benign Het
Lhcgr A G 17: 88,753,856 S256P possibly damaging Het
Lrch4 T A 5: 137,637,730 D348E probably damaging Het
Mettl13 T C 1: 162,544,220 E360G probably damaging Het
Mtss1l C T 8: 110,730,060 S192L probably damaging Het
Myh8 G A 11: 67,284,617 probably benign Het
Myom2 T A 8: 15,102,650 Y666N probably benign Het
Pcdha8 G A 18: 36,993,688 V408M probably damaging Het
Pcdhb3 T C 18: 37,302,825 F615L probably damaging Het
Pitrm1 T C 13: 6,558,235 L333P probably damaging Het
Plxnb1 G T 9: 109,113,458 probably benign Het
Poldip3 A G 15: 83,131,475 probably benign Het
Rgl2 C A 17: 33,932,597 A205D probably benign Het
Rundc3a A G 11: 102,399,259 I175V possibly damaging Het
Rxra A C 2: 27,741,911 Q198P probably damaging Het
Slc25a36 A T 9: 97,100,155 Y42* probably null Het
Slc4a5 A G 6: 83,288,303 D693G probably benign Het
Tmem86b A G 7: 4,628,624 L138P probably damaging Het
Trappc13 C T 13: 104,168,560 D40N probably benign Het
Vmn1r39 T C 6: 66,804,879 S152G probably damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfp35 T C 18: 24,002,925 C109R possibly damaging Het
Predicted Primers PCR Primer
(F):5'- ATGGGTGTGCCTCAAACCTTG -3'
(R):5'- TGCTTTCGTGACCACAGTAAGC -3'

Sequencing Primer
(F):5'- GTGCCTCAAACCTTGCTTCCTTAG -3'
(R):5'- TCGTGACCACAGTAAGCATTCTC -3'
Posted On2015-03-18