Incidental Mutation 'R3757:G530012D18Rik'
ID271465
Institutional Source Beutler Lab
Gene Symbol G530012D18Rik
Ensembl Gene ENSMUSG00000094127
Gene NameRIKEN cDNA G530012D1 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R3757 (G1)
Quality Score190
Status Validated
Chromosome1
Chromosomal Location85575676-85577295 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGA to CAGAGAGAGA at 85577224 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect probably null
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in G530012D18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB001:G530012D18Rik UTSW 1 85577214 missense unknown
BB003:G530012D18Rik UTSW 1 85577214 missense unknown
BB005:G530012D18Rik UTSW 1 85577214 missense unknown
BB006:G530012D18Rik UTSW 1 85577214 missense unknown
BB011:G530012D18Rik UTSW 1 85577214 missense unknown
BB013:G530012D18Rik UTSW 1 85577214 missense unknown
BB015:G530012D18Rik UTSW 1 85577214 missense unknown
BB016:G530012D18Rik UTSW 1 85577214 missense unknown
FR4340:G530012D18Rik UTSW 1 85577152 small deletion probably benign
FR4449:G530012D18Rik UTSW 1 85577180 small deletion probably benign
FR4737:G530012D18Rik UTSW 1 85577178 frame shift probably null
IGL03050:G530012D18Rik UTSW 1 85577224 frame shift probably null
PIT4142001:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R0707:G530012D18Rik UTSW 1 85577224 frame shift probably null
R0730:G530012D18Rik UTSW 1 85577036 utr 3 prime probably benign
R0819:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1053:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1155:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1236:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1245:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1880:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1961:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2033:G530012D18Rik UTSW 1 85577154 frame shift probably null
R2055:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2510:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R2903:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2989:G530012D18Rik UTSW 1 85577216 frame shift probably null
R3000:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3914:G530012D18Rik UTSW 1 85577224 frame shift probably null
R4358:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4407:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4417:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R5086:G530012D18Rik UTSW 1 85577220 utr 3 prime probably benign
R5389:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7212:G530012D18Rik UTSW 1 85577143 missense unknown
R7823:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R7924:G530012D18Rik UTSW 1 85577214 missense unknown
R7926:G530012D18Rik UTSW 1 85577214 missense unknown
R7927:G530012D18Rik UTSW 1 85577214 missense unknown
R7928:G530012D18Rik UTSW 1 85577214 missense unknown
R7929:G530012D18Rik UTSW 1 85577214 missense unknown
R8162:G530012D18Rik UTSW 1 85577214 missense unknown
R8163:G530012D18Rik UTSW 1 85577214 missense unknown
R8164:G530012D18Rik UTSW 1 85577214 missense unknown
R8263:G530012D18Rik UTSW 1 85577214 missense unknown
R8264:G530012D18Rik UTSW 1 85577214 missense unknown
R8265:G530012D18Rik UTSW 1 85577214 missense unknown
X0023:G530012D18Rik UTSW 1 85577224 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACATCGTGAGCGTGTACCAC -3'
(R):5'- ACAGGTGTTTCCTAAAGGGG -3'

Sequencing Primer
(F):5'- TGTACCACAGTGCTGGGTCAG -3'
(R):5'- GGGGGAAACATCAATATTCACAAG -3'
Posted On2015-03-18