Incidental Mutation 'R3757:Lypd1'
ID271466
Institutional Source Beutler Lab
Gene Symbol Lypd1
Ensembl Gene ENSMUSG00000026344
Gene NameLy6/Plaur domain containing 1
Synonyms2700050C12Rik, Lynx2, C530008O16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location125867622-125913101 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 125910384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027582] [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000159417] [ENSMUST00000159529] [ENSMUST00000161361] [ENSMUST00000161954] [ENSMUST00000162877] [ENSMUST00000162899]
Predicted Effect probably benign
Transcript: ENSMUST00000027582
SMART Domains Protein: ENSMUSP00000027582
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
LU 24 122 5.18e-2 SMART
low complexity region 126 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057846
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112583
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159417
SMART Domains Protein: ENSMUSP00000125149
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 23 121 2.5e-4 SMART
low complexity region 125 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159529
SMART Domains Protein: ENSMUSP00000123824
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
Blast:LU 1 69 4e-32 BLAST
low complexity region 73 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160736
Predicted Effect probably benign
Transcript: ENSMUST00000161361
Predicted Effect probably benign
Transcript: ENSMUST00000161954
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162899
SMART Domains Protein: ENSMUSP00000125158
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
Blast:LU 1 69 4e-32 BLAST
low complexity region 73 89 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased fear and anxiety behaviors with increased spontaneous excitatory postsynaptic current following nicotine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Lypd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Lypd1 UTSW 1 125910537 splice site probably benign
R0015:Lypd1 UTSW 1 125910438 missense possibly damaging 0.59
R0537:Lypd1 UTSW 1 125912867 unclassified probably benign
R1838:Lypd1 UTSW 1 125873371 unclassified probably benign
R2045:Lypd1 UTSW 1 125910535 splice site probably benign
R6906:Lypd1 UTSW 1 125910459 missense probably damaging 0.99
R7453:Lypd1 UTSW 1 125873566 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCTGGCAATTAACCCTAATG -3'
(R):5'- AGTGTTTCTGAACCCCACCG -3'

Sequencing Primer
(F):5'- ACATCTGTGCTAACCAGTGAGTG -3'
(R):5'- ACCGCATCTGTCCCACAGG -3'
Posted On2015-03-18