Incidental Mutation 'R3757:Serpinc1'
ID271467
Institutional Source Beutler Lab
Gene Symbol Serpinc1
Ensembl Gene ENSMUSG00000026715
Gene Nameserine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
SynonymsAt3, At-3, antithrombin, ATIII
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160978585-161005863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161002365 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 434 (T434A)
Ref Sequence ENSEMBL: ENSMUSP00000068971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064725] [ENSMUST00000162226] [ENSMUST00000194592] [ENSMUST00000195438]
Predicted Effect probably benign
Transcript: ENSMUST00000064725
AA Change: T434A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068971
Gene: ENSMUSG00000026715
AA Change: T434A

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
SERPIN 93 462 5.55e-173 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162226
SMART Domains Protein: ENSMUSP00000125253
Gene: ENSMUSG00000043467

DomainStartEndE-ValueType
BTB 34 128 1.39e-23 SMART
ZnF_C2H2 375 397 5.99e-4 SMART
ZnF_C2H2 403 425 6.88e-4 SMART
ZnF_C2H2 431 454 1.16e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194570
Predicted Effect probably benign
Transcript: ENSMUST00000194592
SMART Domains Protein: ENSMUSP00000141556
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SERPIN 93 286 8.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195438
SMART Domains Protein: ENSMUSP00000141834
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
Pfam:Serpin 1 97 1.1e-14 PFAM
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit extensive subcutaneous hemorrhage, fibrin deposits in the myocardium and liver, and lethality by embryonic day 16.5. Heterozygotes challenged with lipopolysaccharide show increased fibrin deposits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Serpinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Serpinc1 APN 1 160993400 missense probably damaging 1.00
IGL01923:Serpinc1 APN 1 160989546 missense probably damaging 0.98
IGL01987:Serpinc1 APN 1 160993407 missense probably damaging 1.00
IGL02272:Serpinc1 APN 1 160999992 missense probably damaging 1.00
IGL02574:Serpinc1 APN 1 161002459 missense probably benign 0.00
IGL02730:Serpinc1 APN 1 161000028 missense probably damaging 0.97
IGL02861:Serpinc1 APN 1 160999991 missense probably damaging 0.99
IGL03377:Serpinc1 APN 1 160993442 missense probably damaging 1.00
R0277:Serpinc1 UTSW 1 160989702 start codon destroyed probably null 1.00
R1294:Serpinc1 UTSW 1 160989641 missense probably damaging 0.98
R1368:Serpinc1 UTSW 1 160993524 missense probably damaging 1.00
R1433:Serpinc1 UTSW 1 160993404 missense probably damaging 0.97
R1436:Serpinc1 UTSW 1 160993411 missense possibly damaging 0.63
R1480:Serpinc1 UTSW 1 160995319 missense probably benign 0.00
R1703:Serpinc1 UTSW 1 160993517 missense probably damaging 1.00
R1775:Serpinc1 UTSW 1 160989647 missense probably benign 0.07
R2007:Serpinc1 UTSW 1 160993540 missense probably benign 0.05
R5134:Serpinc1 UTSW 1 160997570 splice site probably null
R5252:Serpinc1 UTSW 1 160989621 missense probably damaging 1.00
R7033:Serpinc1 UTSW 1 160997521 missense probably benign 0.04
R7254:Serpinc1 UTSW 1 160993618 missense probably benign 0.01
R7262:Serpinc1 UTSW 1 160989659 missense probably damaging 1.00
R7429:Serpinc1 UTSW 1 160995441 missense probably benign 0.03
R8169:Serpinc1 UTSW 1 160993401 missense probably damaging 1.00
Z1176:Serpinc1 UTSW 1 160989456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAAACCAGCAGTGTGAGC -3'
(R):5'- GGTGTAGCATCTGTACTCCAG -3'

Sequencing Primer
(F):5'- CAGTGTGAGCGCTGGGTC -3'
(R):5'- CTCGTCTTCAAGTGGAAAAGTCC -3'
Posted On2015-03-18