Incidental Mutation 'R3757:Olfr1287'
ID271468
Institutional Source Beutler Lab
Gene Symbol Olfr1287
Ensembl Gene ENSMUSG00000095586
Gene Nameolfactory receptor 1287
SynonymsMOR248-15, GA_x6K02T2Q125-72500603-72501520
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111449142-111450059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111449257 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 39 (V39E)
Ref Sequence ENSEMBL: ENSMUSP00000074850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075390]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075390
AA Change: V39E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074850
Gene: ENSMUSG00000095586
AA Change: V39E

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.7e-48 PFAM
Pfam:7tm_1 41 287 9.5e-20 PFAM
Meta Mutation Damage Score 0.6864 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Olfr1287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Olfr1287 APN 2 111449889 missense probably benign 0.13
IGL01748:Olfr1287 APN 2 111449530 missense probably damaging 1.00
IGL02264:Olfr1287 APN 2 111449862 missense probably benign 0.05
IGL02371:Olfr1287 APN 2 111450009 missense probably damaging 1.00
IGL02385:Olfr1287 APN 2 111449350 missense probably damaging 1.00
IGL02704:Olfr1287 APN 2 111449147 missense probably benign 0.00
R0368:Olfr1287 UTSW 2 111449788 missense probably benign 0.07
R1520:Olfr1287 UTSW 2 111449274 missense probably benign 0.00
R2036:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R2890:Olfr1287 UTSW 2 111449289 missense probably benign 0.12
R3801:Olfr1287 UTSW 2 111449565 missense probably benign 0.07
R3958:Olfr1287 UTSW 2 111449885 missense possibly damaging 0.50
R4077:Olfr1287 UTSW 2 111449503 missense probably damaging 0.99
R4763:Olfr1287 UTSW 2 111449678 nonsense probably null
R4955:Olfr1287 UTSW 2 111449605 missense probably damaging 1.00
R4975:Olfr1287 UTSW 2 111449683 missense probably benign 0.16
R5046:Olfr1287 UTSW 2 111449589 missense probably benign 0.01
R5512:Olfr1287 UTSW 2 111449754 missense probably benign 0.00
R5708:Olfr1287 UTSW 2 111450009 missense probably damaging 1.00
R5771:Olfr1287 UTSW 2 111450061 splice site probably null
R5780:Olfr1287 UTSW 2 111449833 missense probably benign 0.03
R6981:Olfr1287 UTSW 2 111449352 missense probably benign 0.00
R7073:Olfr1287 UTSW 2 111449286 missense probably benign 0.22
R7633:Olfr1287 UTSW 2 111449622 missense probably benign
R7963:Olfr1287 UTSW 2 111449626 missense possibly damaging 0.80
R8121:Olfr1287 UTSW 2 111449160 missense probably benign 0.20
RF037:Olfr1287 UTSW 2 111449551 missense not run
RF039:Olfr1287 UTSW 2 111449551 missense not run
Z1088:Olfr1287 UTSW 2 111449457 missense probably benign 0.02
Z1176:Olfr1287 UTSW 2 111449784 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTTGAGTGGAAACAATGTTAAGAC -3'
(R):5'- GCCATTGTTACAAGAAGCACCATC -3'

Sequencing Primer
(F):5'- AGACTGTGGTCTCTGAGT -3'
(R):5'- CAGAGGATCTGGCTCATGCAG -3'
Posted On2015-03-18