Incidental Mutation 'R3757:Slc9a8'
ID271470
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 167424130 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 9 (T9K)
Ref Sequence ENSEMBL: ENSMUSP00000104841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: T9K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: T9K

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: T9K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: T9K

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: T9K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: T9K

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150326
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167465358 missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167468971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATAATAGAAGTCTCTGGTGTGC -3'
(R):5'- AGACATTGCTCTCTGGAACTGC -3'

Sequencing Primer
(F):5'- CTTTGTAGGCAGGAGTTCCTC -3'
(R):5'- CTGTGGGCTTATTCACCTAGGAC -3'
Posted On2015-03-18