Mutagenetix > Incidental Mutation

Incidental Mutation 'R3757:Slc9a8'

271470

Institutional Source

Beutler Lab

Gene Symbol

Slc9a8

Ensembl Gene

ENSMUSG00000039463

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 8

Synonyms

1200006P13Rik, 6430709P13Rik, NHE8

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3757 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

167421712-167477000 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 167424130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 9 (T9K)

Ref Sequence

ENSEMBL: ENSMUSP00000104841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]

AlphaFold

Q8R4D1

Predicted Effect

probably benign
Transcript: ENSMUST00000047815
AA Change: T9K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: T9K

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	57	468	3.3e-69	PFAM
low complexity region	497	513	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000073873
AA Change: T9K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: T9K

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	54	441	3.5e-62	PFAM
low complexity region	470	486	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109218
AA Change: T9K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: T9K

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	54	437	3.7e-61	PFAM
low complexity region	466	482	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131956

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135353

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139673

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141400

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149607

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150326

Meta Mutation Damage Score

0.0628

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

92% (35/38)

MGI Phenotype

FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	T	A	7: 82,337,207	I9K	probably benign	Het
Arhgap31	T	C	16: 38,637,000	E82G	probably damaging	Het
Asap2	T	A	12: 21,267,766	S993T	probably damaging	Het
Bmpr1a	A	T	14: 34,434,667	L134*	probably null	Het
Cacna1e	A	G	1: 154,633,696	V271A	probably damaging	Het
Cacna2d4	A	G	6: 119,241,163	E153G	probably damaging	Het
Cage1	A	C	13: 38,025,729	F91V	possibly damaging	Het
Cdh24	T	C	14: 54,632,180	D760G	possibly damaging	Het
Col9a1	T	C	1: 24,232,231		probably null	Het
Cts6	A	T	13: 61,202,158	Y36*	probably null	Het
Dennd3	C	G	15: 73,522,234	A36G	probably benign	Het
Dmxl1	G	A	18: 49,935,317	G2719D	probably damaging	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Ep300	T	A	15: 81,648,589	V1676E	unknown	Het
Ercc4	C	T	16: 13,144,496	T668M	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gm10985	GCTCTCTCTCTCTCTCTCTCTCTCTCTCT	GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT	3: 53,845,224		probably null	Het
Havcr1	G	T	11: 46,752,580	R109L	probably damaging	Het
Hist1h1e	T	A	13: 23,622,257	K81*	probably null	Het
Krtap4-9	A	G	11: 99,785,618		probably benign	Het
Layn	T	C	9: 51,059,556	E229G	probably benign	Het
Lpcat3	T	A	6: 124,699,992		probably null	Het
Lrrn1	T	A	6: 107,569,208	F656I	possibly damaging	Het
Lypd1	A	G	1: 125,910,384		probably benign	Het
Olfr111	T	A	17: 37,530,355	I126N	probably damaging	Het
Olfr1287	T	A	2: 111,449,257	V39E	possibly damaging	Het
Olfr777	T	C	10: 129,269,065	D86G	probably damaging	Het
Ptprt	A	T	2: 161,812,030	L560Q	probably damaging	Het
Rbm11	T	C	16: 75,596,581	V55A	probably damaging	Het
Scn11a	C	T	9: 119,803,503	V434I	probably benign	Het
Serpinc1	A	G	1: 161,002,365	T434A	probably benign	Het
Setd2	T	C	9: 110,573,685	I1798T	probably damaging	Het
Sfswap	A	G	5: 129,513,234	Y265C	probably damaging	Het
Synpo	T	C	18: 60,602,990	D389G	probably damaging	Het
Vmn1r181	C	T	7: 23,984,484	L125F	possibly damaging	Het
Wdfy4	A	C	14: 33,023,374	H2296Q	probably benign	Het

Other mutations in Slc9a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01616:Slc9a8	APN	2	167424166	missense	possibly damaging	0.46
IGL02626:Slc9a8	APN	2	167467677	splice site	probably benign
costello	UTSW	2	167451296	missense	probably damaging	1.00
R0270:Slc9a8	UTSW	2	167451296	missense	probably damaging	1.00
R0417:Slc9a8	UTSW	2	167457344	missense	probably benign	0.00
R0504:Slc9a8	UTSW	2	167424205	missense	probably benign
R0906:Slc9a8	UTSW	2	167434867	intron	probably benign
R1216:Slc9a8	UTSW	2	167424121	missense	probably benign	0.00
R1225:Slc9a8	UTSW	2	167471523	missense	probably benign	0.20
R1604:Slc9a8	UTSW	2	167471432	missense	probably benign	0.09
R1728:Slc9a8	UTSW	2	167424145	missense	probably benign	0.00
R1729:Slc9a8	UTSW	2	167424145	missense	probably benign	0.00
R1773:Slc9a8	UTSW	2	167471465	missense	possibly damaging	0.57
R1775:Slc9a8	UTSW	2	167457358	missense	probably benign	0.12
R1918:Slc9a8	UTSW	2	167424214	missense	possibly damaging	0.95
R2312:Slc9a8	UTSW	2	167451276	missense	probably benign	0.01
R3031:Slc9a8	UTSW	2	167451281	missense	probably damaging	1.00
R3752:Slc9a8	UTSW	2	167457352	missense	probably benign
R4499:Slc9a8	UTSW	2	167424193	missense	probably benign	0.01
R4746:Slc9a8	UTSW	2	167441170	nonsense	probably null
R4904:Slc9a8	UTSW	2	167471396	missense	possibly damaging	0.51
R4969:Slc9a8	UTSW	2	167446529	missense	probably benign	0.06
R5395:Slc9a8	UTSW	2	167467722	missense	probably damaging	0.99
R5811:Slc9a8	UTSW	2	167471387	nonsense	probably null
R5908:Slc9a8	UTSW	2	167451170	intron	probably benign
R6311:Slc9a8	UTSW	2	167451220	missense	probably damaging	1.00
R6443:Slc9a8	UTSW	2	167434821	missense	probably benign	0.00
R6494:Slc9a8	UTSW	2	167424291	missense	probably damaging	1.00
R7161:Slc9a8	UTSW	2	167465383	missense	possibly damaging	0.90
R7322:Slc9a8	UTSW	2	167451302	missense	probably damaging	1.00
R7354:Slc9a8	UTSW	2	167474131	missense	possibly damaging	0.93
R7896:Slc9a8	UTSW	2	167465358	missense	probably benign	0.07
R8095:Slc9a8	UTSW	2	167468971	missense	probably damaging	0.99
R8725:Slc9a8	UTSW	2	167473534	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATAATAGAAGTCTCTGGTGTGC -3'
(R):5'- AGACATTGCTCTCTGGAACTGC -3'

Sequencing Primer
(F):5'- CTTTGTAGGCAGGAGTTCCTC -3'
(R):5'- CTGTGGGCTTATTCACCTAGGAC -3'

Posted On

2015-03-18