Incidental Mutation 'R3757:Sfswap'
ID271475
Institutional Source Beutler Lab
Gene Symbol Sfswap
Ensembl Gene ENSMUSG00000029439
Gene Namesplicing factor SWAP
SynonymsSfrs8, 6330437E22Rik, 1190005N23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location129501221-129571384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129513234 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 265 (Y265C)
Ref Sequence ENSEMBL: ENSMUSP00000062413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053737] [ENSMUST00000196698]
Predicted Effect probably damaging
Transcript: ENSMUST00000053737
AA Change: Y265C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062413
Gene: ENSMUSG00000029439
AA Change: Y265C

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 157 1.15e-57 SMART
low complexity region 160 170 N/A INTRINSIC
low complexity region 174 186 N/A INTRINSIC
SWAP 209 262 3.94e-19 SMART
low complexity region 286 293 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
low complexity region 397 441 N/A INTRINSIC
SWAP 456 507 9.55e-18 SMART
low complexity region 513 532 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 598 607 N/A INTRINSIC
coiled coil region 631 686 N/A INTRINSIC
low complexity region 741 788 N/A INTRINSIC
low complexity region 797 821 N/A INTRINSIC
low complexity region 840 865 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
low complexity region 889 905 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196698
SMART Domains Protein: ENSMUSP00000142464
Gene: ENSMUSG00000029439

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
DRY_EERY 33 121 1.8e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200662
Meta Mutation Damage Score 0.7646 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a human homolog of Drosophila splicing regulatory protein. This gene autoregulates its expression by control of splicing of its first two introns. In addition, it also regulates the splicing of fibronectin and CD45 genes. Two transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit a wobbly phenotype with inner ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Sfswap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Sfswap APN 5 129513233 missense probably damaging 1.00
IGL02064:Sfswap APN 5 129560796 missense probably benign 0.17
IGL02083:Sfswap APN 5 129539791 missense probably benign
IGL02378:Sfswap APN 5 129539604 missense probably damaging 1.00
FR4340:Sfswap UTSW 5 129569751 unclassified probably benign
FR4342:Sfswap UTSW 5 129569757 unclassified probably benign
FR4449:Sfswap UTSW 5 129569748 unclassified probably benign
FR4449:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569749 unclassified probably benign
FR4548:Sfswap UTSW 5 129569755 unclassified probably benign
FR4737:Sfswap UTSW 5 129569756 unclassified probably benign
FR4976:Sfswap UTSW 5 129569751 unclassified probably benign
I1329:Sfswap UTSW 5 129507137 unclassified probably benign
P0033:Sfswap UTSW 5 129539755 missense possibly damaging 0.60
R0184:Sfswap UTSW 5 129507189 missense probably damaging 0.97
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0233:Sfswap UTSW 5 129554543 missense possibly damaging 0.82
R0414:Sfswap UTSW 5 129504051 missense possibly damaging 0.83
R0415:Sfswap UTSW 5 129504126 missense probably damaging 1.00
R0570:Sfswap UTSW 5 129503978 splice site probably benign
R1018:Sfswap UTSW 5 129554576 missense possibly damaging 0.91
R1173:Sfswap UTSW 5 129507143 critical splice acceptor site probably null
R1298:Sfswap UTSW 5 129541378 missense probably benign 0.14
R1723:Sfswap UTSW 5 129539694 missense probably benign
R1783:Sfswap UTSW 5 129513240 missense possibly damaging 0.92
R1828:Sfswap UTSW 5 129513084 missense probably damaging 1.00
R1879:Sfswap UTSW 5 129541328 missense probably benign 0.01
R2078:Sfswap UTSW 5 129516107 missense possibly damaging 0.81
R2349:Sfswap UTSW 5 129569738 missense possibly damaging 0.87
R4093:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4094:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4095:Sfswap UTSW 5 129560741 missense possibly damaging 0.85
R4785:Sfswap UTSW 5 129513083 missense probably damaging 1.00
R5139:Sfswap UTSW 5 129571009 missense possibly damaging 0.73
R5355:Sfswap UTSW 5 129539746 missense probably benign 0.09
R5481:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5600:Sfswap UTSW 5 129513158 missense probably damaging 1.00
R5686:Sfswap UTSW 5 129514818 missense probably damaging 0.98
R5906:Sfswap UTSW 5 129542043 missense probably benign 0.22
R6332:Sfswap UTSW 5 129571041 missense possibly damaging 0.91
R6738:Sfswap UTSW 5 129541441 missense probably damaging 0.98
R6743:Sfswap UTSW 5 129550819 nonsense probably null
R7371:Sfswap UTSW 5 129543241 missense probably benign 0.01
R7747:Sfswap UTSW 5 129550593 intron probably null
RF003:Sfswap UTSW 5 129569764 unclassified probably benign
RF042:Sfswap UTSW 5 129569743 unclassified probably benign
RF049:Sfswap UTSW 5 129569744 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AATGCATGCCATCATTGAGCG -3'
(R):5'- ATGACCACTTGGCTCTCACC -3'

Sequencing Primer
(F):5'- TGCCATCATTGAGCGCACAG -3'
(R):5'- CAACCATCTGGAAAGTATGGATTG -3'
Posted On2015-03-18