Incidental Mutation 'R3757:Lrrn1'
ID271476
Institutional Source Beutler Lab
Gene Symbol Lrrn1
Ensembl Gene ENSMUSG00000034648
Gene Nameleucine rich repeat protein 1, neuronal
Synonyms2810047E21Rik, NLRR-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location107529768-107570214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107569208 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 656 (F656I)
Ref Sequence ENSEMBL: ENSMUSP00000037096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049285]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049285
AA Change: F656I

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037096
Gene: ENSMUSG00000034648
AA Change: F656I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 31 76 2.89e-1 SMART
LRR 94 117 1.06e1 SMART
LRR 118 141 1.89e-1 SMART
LRR_TYP 142 165 4.3e-5 SMART
LRR 166 189 1.76e-1 SMART
LRR 214 237 4.09e1 SMART
LRR 238 261 1.53e1 SMART
LRR 262 285 2.63e0 SMART
LRR 311 335 1.45e2 SMART
LRR 336 359 4.21e1 SMART
LRRCT 371 423 2.14e-10 SMART
IGc2 438 506 6.34e-15 SMART
FN3 523 605 8.71e-2 SMART
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 690 701 N/A INTRINSIC
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited decreased exploratory activity and the female mutants exhibited an increased anxiety-like response during open field testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Lrrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrrn1 APN 6 107568308 missense probably benign 0.06
IGL00949:Lrrn1 APN 6 107569300 missense probably benign 0.15
IGL01594:Lrrn1 APN 6 107567493 missense probably damaging 0.99
IGL02814:Lrrn1 APN 6 107567352 missense probably damaging 1.00
IGL02824:Lrrn1 APN 6 107568534 missense possibly damaging 0.57
IGL02931:Lrrn1 APN 6 107567748 missense probably damaging 1.00
R0399:Lrrn1 UTSW 6 107569120 missense probably benign
R1109:Lrrn1 UTSW 6 107567264 missense probably benign
R1620:Lrrn1 UTSW 6 107568366 missense probably damaging 1.00
R1826:Lrrn1 UTSW 6 107567568 missense probably benign 0.05
R1893:Lrrn1 UTSW 6 107568122 missense possibly damaging 0.82
R2327:Lrrn1 UTSW 6 107568833 missense probably benign 0.05
R3684:Lrrn1 UTSW 6 107567949 missense probably benign 0.13
R4538:Lrrn1 UTSW 6 107568637 missense probably benign 0.21
R4922:Lrrn1 UTSW 6 107568350 missense probably damaging 1.00
R4946:Lrrn1 UTSW 6 107568890 missense probably benign 0.16
R4970:Lrrn1 UTSW 6 107569344 missense probably benign 0.06
R4977:Lrrn1 UTSW 6 107568707 missense probably benign
R5121:Lrrn1 UTSW 6 107569207 missense possibly damaging 0.89
R5186:Lrrn1 UTSW 6 107569224 missense probably damaging 1.00
R5625:Lrrn1 UTSW 6 107567354 missense probably damaging 0.99
R5736:Lrrn1 UTSW 6 107567384 missense probably damaging 1.00
R5873:Lrrn1 UTSW 6 107568975 missense probably damaging 0.98
R5949:Lrrn1 UTSW 6 107567504 missense probably benign 0.00
R6046:Lrrn1 UTSW 6 107568527 missense probably benign 0.00
R6370:Lrrn1 UTSW 6 107569224 missense probably damaging 1.00
R7138:Lrrn1 UTSW 6 107568375 missense probably damaging 1.00
R7169:Lrrn1 UTSW 6 107567604 missense probably damaging 1.00
R7413:Lrrn1 UTSW 6 107569122 missense probably benign 0.00
R7449:Lrrn1 UTSW 6 107568521 missense possibly damaging 0.91
R7969:Lrrn1 UTSW 6 107567850 missense probably damaging 1.00
R8077:Lrrn1 UTSW 6 107568822 missense probably damaging 0.99
R8288:Lrrn1 UTSW 6 107566994 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACGGTGTCCAACATCCATCAG -3'
(R):5'- TGTGCTCCTTACTACCAGAAGC -3'

Sequencing Primer
(F):5'- GTGTCCAACATCCATCAGCAGAC -3'
(R):5'- CCACATGTAATAGCTTCTGGATGTG -3'
Posted On2015-03-18