Incidental Mutation 'R3757:Lpcat3'
ID271478
Institutional Source Beutler Lab
Gene Symbol Lpcat3
Ensembl Gene ENSMUSG00000004270
Gene Namelysophosphatidylcholine acyltransferase 3
SynonymsMboat5, Grcc3f, Oact5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124663027-124704418 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 124699992 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004379] [ENSMUST00000004381] [ENSMUST00000128721]
Predicted Effect probably benign
Transcript: ENSMUST00000004379
SMART Domains Protein: ENSMUSP00000004379
Gene: ENSMUSG00000004268

DomainStartEndE-ValueType
Pfam:EMG1 45 238 2.9e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000004381
SMART Domains Protein: ENSMUSP00000004381
Gene: ENSMUSG00000004270

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Pfam:MBOAT 126 437 1.2e-81 PFAM
transmembrane domain 454 473 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125795
Predicted Effect probably benign
Transcript: ENSMUST00000128721
SMART Domains Protein: ENSMUSP00000144738
Gene: ENSMUSG00000004270

DomainStartEndE-ValueType
transmembrane domain 41 63 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135516
SMART Domains Protein: ENSMUSP00000122436
Gene: ENSMUSG00000004270

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204334
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Nullizygous mice show low blood glucose levels and postnatal death. Intestine-specific knockouts fail to thrive and show enterocyte lipid accumulation and low plasma triglycerides (TGs). Liver-specific knockouts show low plasma TGs, fatty liver, and secrete VLDL lacking arachidonoyl phospholipids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Lpcat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Lpcat3 APN 6 124699338 missense possibly damaging 0.78
IGL02279:Lpcat3 APN 6 124698109 missense probably damaging 1.00
IGL02869:Lpcat3 APN 6 124703007 missense possibly damaging 0.65
R0045:Lpcat3 UTSW 6 124701474 missense probably benign 0.12
R0045:Lpcat3 UTSW 6 124701474 missense probably benign 0.12
R2075:Lpcat3 UTSW 6 124703103 missense probably damaging 1.00
R4181:Lpcat3 UTSW 6 124703224 unclassified probably benign
R4583:Lpcat3 UTSW 6 124703323 missense possibly damaging 0.92
R5134:Lpcat3 UTSW 6 124702530 missense probably benign 0.00
R5159:Lpcat3 UTSW 6 124699394 intron probably benign
R6703:Lpcat3 UTSW 6 124663222 missense probably benign 0.02
R6833:Lpcat3 UTSW 6 124700011 missense probably damaging 1.00
R7261:Lpcat3 UTSW 6 124698087 missense probably benign 0.02
R7604:Lpcat3 UTSW 6 124702530 missense probably benign 0.00
X0017:Lpcat3 UTSW 6 124698118 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGGTAACGCCCCTGTTTGTAG -3'
(R):5'- TGGAGCATGACATCAGTATGG -3'

Sequencing Primer
(F):5'- CTCTCAAGTGCCAGGATTCTAGG -3'
(R):5'- ACATCAGTATGGTTTATTTTGGCTC -3'
Posted On2015-03-18