Incidental Mutation 'R3757:Vmn1r181'
ID271480
Institutional Source Beutler Lab
Gene Symbol Vmn1r181
Ensembl Gene ENSMUSG00000097425
Gene Namevomeronasal 1 receptor 181
SynonymsV1rd20
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23974615-23988139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23984484 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 125 (L125F)
Ref Sequence ENSEMBL: ENSMUSP00000154403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181796] [ENSMUST00000226843] [ENSMUST00000226978] [ENSMUST00000227637] [ENSMUST00000228399] [ENSMUST00000228842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077386
AA Change: L125F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076604
Gene: ENSMUSG00000057946
AA Change: L125F

DomainStartEndE-ValueType
Pfam:TAS2R 8 295 3.6e-12 PFAM
Pfam:7tm_1 30 282 4.6e-7 PFAM
Pfam:V1R 41 295 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181796
AA Change: L125F

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137685
Gene: ENSMUSG00000097425
AA Change: L125F

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 3.9e-9 PFAM
Pfam:V1R 41 295 2.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226843
AA Change: L125F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226978
AA Change: L125F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227637
AA Change: L125F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228399
AA Change: L125F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228607
Predicted Effect possibly damaging
Transcript: ENSMUST00000228842
AA Change: L125F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Vmn1r181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Vmn1r181 APN 7 23984581 missense possibly damaging 0.91
IGL02055:Vmn1r181 APN 7 23984553 missense probably damaging 1.00
IGL02444:Vmn1r181 APN 7 23984523 missense probably damaging 1.00
IGL03012:Vmn1r181 APN 7 23984602 missense probably damaging 0.98
IGL03026:Vmn1r181 APN 7 23984575 missense possibly damaging 0.94
R0255:Vmn1r181 UTSW 7 23984334 missense probably benign 0.02
R1481:Vmn1r181 UTSW 7 23984712 missense probably damaging 1.00
R2847:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R2848:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R2849:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R3441:Vmn1r181 UTSW 7 23984883 missense probably benign 0.05
R3945:Vmn1r181 UTSW 7 23984152 missense probably damaging 0.98
R3983:Vmn1r181 UTSW 7 23984809 missense probably benign 0.23
R4780:Vmn1r181 UTSW 7 23984583 missense possibly damaging 0.64
R4999:Vmn1r181 UTSW 7 23984365 missense probably damaging 0.99
R5463:Vmn1r181 UTSW 7 23984362 missense probably benign 0.02
R5672:Vmn1r181 UTSW 7 23984316 missense probably damaging 1.00
R6229:Vmn1r181 UTSW 7 23984155 missense probably damaging 1.00
R6315:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6316:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6317:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6324:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6326:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6988:Vmn1r181 UTSW 7 23984847 missense probably damaging 1.00
R7446:Vmn1r181 UTSW 7 23984931 missense probably benign 0.01
R7972:Vmn1r181 UTSW 7 23984446 missense probably benign 0.30
X0067:Vmn1r181 UTSW 7 23984901 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATAGCTGTGGCCAATGC -3'
(R):5'- TGTGGCATCATGGGCAAATCG -3'

Sequencing Primer
(F):5'- AATGCCTTGACTCTCTTCATCACTAC -3'
(R):5'- GAAGACAATACCCACATTAAATCCAG -3'
Posted On2015-03-18