Incidental Mutation 'R3757:Layn'
ID271482
Institutional Source Beutler Lab
Gene Symbol Layn
Ensembl Gene ENSMUSG00000060594
Gene Namelayilin
SynonymsLOC244864, E030012M19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3757 (G1)
Quality Score202
Status Validated
Chromosome9
Chromosomal Location51054640-51077094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51059556 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 229 (E229G)
Ref Sequence ENSEMBL: ENSMUSP00000150681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098782] [ENSMUST00000214452] [ENSMUST00000217212]
Predicted Effect probably benign
Transcript: ENSMUST00000098782
AA Change: E229G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000096379
Gene: ENSMUSG00000060594
AA Change: E229G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CLECT 41 185 6.18e-25 SMART
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216453
Predicted Effect probably benign
Transcript: ENSMUST00000217212
AA Change: E229G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0902 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Layn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Layn APN 9 51057408 missense probably damaging 1.00
IGL01145:Layn APN 9 51074046 missense probably benign 0.01
IGL02006:Layn APN 9 51057291 intron probably benign
IGL02226:Layn APN 9 51074017 missense probably damaging 1.00
PIT4677001:Layn UTSW 9 51057411 missense probably damaging 0.98
R1464:Layn UTSW 9 51057586 missense probably damaging 1.00
R1464:Layn UTSW 9 51057586 missense probably damaging 1.00
R1775:Layn UTSW 9 51059533 missense probably benign 0.03
R2156:Layn UTSW 9 51057397 missense probably benign
R3732:Layn UTSW 9 51059544 missense probably damaging 1.00
R3732:Layn UTSW 9 51059544 missense probably damaging 1.00
R3733:Layn UTSW 9 51059544 missense probably damaging 1.00
R4840:Layn UTSW 9 51057382 missense probably damaging 1.00
R5792:Layn UTSW 9 51068161 missense probably damaging 1.00
R7185:Layn UTSW 9 51073873 missense possibly damaging 0.58
R7216:Layn UTSW 9 51077052 start gained probably benign
R7404:Layn UTSW 9 51057370 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTCATGGCCTTTAATGATGCC -3'
(R):5'- ACTGCATCTATCTCCTAGAATGTGC -3'

Sequencing Primer
(F):5'- GCCTTTAATGATGCCAGCCAG -3'
(R):5'- TCTATCTCCTAGAATGTGCTGTTTAG -3'
Posted On2015-03-18