Incidental Mutation 'R3757:Olfr777'
ID271485
Institutional Source Beutler Lab
Gene Symbol Olfr777
Ensembl Gene ENSMUSG00000062914
Gene Nameolfactory receptor 777
SynonymsGA_x6K02T2PULF-10955551-10954616, MOR114-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129264407-129271485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129269065 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000145475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080313] [ENSMUST00000204573] [ENSMUST00000213512]
Predicted Effect probably damaging
Transcript: ENSMUST00000080313
AA Change: D86G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079191
Gene: ENSMUSG00000062914
AA Change: D86G

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204573
AA Change: D86G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145475
Gene: ENSMUSG00000062914
AA Change: D86G

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.4e-42 PFAM
Pfam:7tm_1 38 287 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213512
Meta Mutation Damage Score 0.1812 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Olfr777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Olfr777 APN 10 129268523 missense probably benign 0.18
IGL01782:Olfr777 APN 10 129269039 missense probably benign 0.00
R0554:Olfr777 UTSW 10 129268499 missense probably benign 0.00
R0594:Olfr777 UTSW 10 129269152 missense possibly damaging 0.95
R1792:Olfr777 UTSW 10 129269243 missense probably benign 0.20
R2357:Olfr777 UTSW 10 129268773 missense probably benign 0.31
R2426:Olfr777 UTSW 10 129269266 missense probably benign 0.00
R3758:Olfr777 UTSW 10 129269065 missense probably damaging 0.99
R3962:Olfr777 UTSW 10 129268666 missense probably damaging 1.00
R4600:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R4603:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R4611:Olfr777 UTSW 10 129268405 missense probably benign 0.01
R5113:Olfr777 UTSW 10 129268666 missense probably damaging 0.98
R6415:Olfr777 UTSW 10 129269021 missense probably benign 0.01
R7540:Olfr777 UTSW 10 129269134 missense probably benign 0.31
R7909:Olfr777 UTSW 10 129269267 missense probably benign 0.00
R8170:Olfr777 UTSW 10 129269048 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCAGCAACTGAGGATAAGTCTTG -3'
(R):5'- GACTGACGGATGATCCACAAC -3'

Sequencing Primer
(F):5'- CTGAGGATAAGTCTTGCACAGATCC -3'
(R):5'- GGATGATCCACAACTGAAAACTCTG -3'
Posted On2015-03-18