Incidental Mutation 'R3757:Krtap4-9'
ID271488
Institutional Source Beutler Lab
Gene Symbol Krtap4-9
Ensembl Gene ENSMUSG00000078262
Gene Namekeratin associated protein 4-9
SynonymsOTTMUSG00000002198
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99785200-99786258 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 99785618 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105059] [ENSMUST00000107439]
Predicted Effect unknown
Transcript: ENSMUST00000105059
AA Change: T122A
SMART Domains Protein: ENSMUSP00000100680
Gene: ENSMUSG00000078262
AA Change: T122A

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 1.2e-8 PFAM
Pfam:Keratin_B2_2 14 58 4.4e-13 PFAM
Pfam:Keratin_B2_2 54 102 3e-10 PFAM
Pfam:Keratin_B2_2 87 132 8.4e-12 PFAM
Pfam:Keratin_B2_2 98 147 3.4e-9 PFAM
Pfam:Keratin_B2_2 138 182 3.1e-12 PFAM
Pfam:Keratin_B2_2 178 222 4.8e-12 PFAM
Pfam:Keratin_B2_2 203 244 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107439
SMART Domains Protein: ENSMUSP00000103063
Gene: ENSMUSG00000089724

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 14 58 1.8e-13 PFAM
Pfam:Keratin_B2_2 54 98 6.7e-15 PFAM
Pfam:Keratin_B2_2 94 138 9.5e-15 PFAM
Pfam:Keratin_B2_2 138 182 1.5e-12 PFAM
Pfam:Keratin_B2_2 168 209 8.2e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Krtap4-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Krtap4-9 APN 11 99785565 unclassified probably benign
IGL02697:Krtap4-9 APN 11 99785748 missense unknown
IGL03176:Krtap4-9 APN 11 99785280 unclassified probably benign
R0988:Krtap4-9 UTSW 11 99785536 nonsense probably null
R1773:Krtap4-9 UTSW 11 99785570 unclassified probably benign
R1838:Krtap4-9 UTSW 11 99785396 unclassified probably benign
R2566:Krtap4-9 UTSW 11 99785666 unclassified probably benign
R2888:Krtap4-9 UTSW 11 99785419 nonsense probably null
R4633:Krtap4-9 UTSW 11 99785554 unclassified probably benign
R5930:Krtap4-9 UTSW 11 99785636 unclassified probably benign
R6092:Krtap4-9 UTSW 11 99785655 unclassified probably benign
R6501:Krtap4-9 UTSW 11 99785429 unclassified probably benign
R6934:Krtap4-9 UTSW 11 99785882 nonsense probably null
R7131:Krtap4-9 UTSW 11 99785457 missense unknown
RF017:Krtap4-9 UTSW 11 99785399 unclassified probably benign
RF023:Krtap4-9 UTSW 11 99785391 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CATGGTCAGCTCCTGTTGTG -3'
(R):5'- TAGAACTACCACAGCAGGGG -3'

Sequencing Primer
(F):5'- CCCAGTGTTGCCAGTCTGTG -3'
(R):5'- CAGCTGGAAATGCAACAG -3'
Posted On2015-03-18