Incidental Mutation 'R3757:Cage1'
ID271491
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Namecancer antigen 1
SynonymsCtag3, 4933427I01Rik, CAGE1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38006052-38037069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38025729 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 91 (F91V)
Ref Sequence ENSEMBL: ENSMUSP00000122393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000089840] [ENSMUST00000110233] [ENSMUST00000131066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074969
AA Change: F91V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: F91V

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089840
SMART Domains Protein: ENSMUSP00000087278
Gene: ENSMUSG00000044566

DomainStartEndE-ValueType
Pfam:CAGE1 1 420 6.8e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110233
AA Change: F91V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: F91V

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131066
AA Change: F91V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122393
Gene: ENSMUSG00000044566
AA Change: F91V

DomainStartEndE-ValueType
Pfam:CAGE1 1 318 6.5e-167 PFAM
Meta Mutation Damage Score 0.1466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38022993 nonsense probably null
IGL01736:Cage1 APN 13 38022813 missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38022529 missense probably damaging 1.00
IGL02267:Cage1 APN 13 38023257 missense probably damaging 1.00
IGL03030:Cage1 APN 13 38028147 missense probably benign
IGL03216:Cage1 APN 13 38006177 splice site probably benign
R0487:Cage1 UTSW 13 38025358 missense probably benign 0.00
R0606:Cage1 UTSW 13 38016494 splice site probably benign
R1015:Cage1 UTSW 13 38016475 missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38022880 missense probably damaging 1.00
R1400:Cage1 UTSW 13 38032424 missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38023333 nonsense probably null
R2057:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2058:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2059:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2197:Cage1 UTSW 13 38023053 missense probably damaging 1.00
R3758:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38019177 missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38025650 missense probably damaging 1.00
R4401:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4402:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4403:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4490:Cage1 UTSW 13 38023417 missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38025501 missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38019208 missense probably benign 0.33
R4950:Cage1 UTSW 13 38023326 missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38023430 missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38011411 nonsense probably null
R5808:Cage1 UTSW 13 38022325 unclassified probably benign
R5845:Cage1 UTSW 13 38015706 missense probably damaging 0.96
R6278:Cage1 UTSW 13 38016419 missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38025449 missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38022558 missense probably damaging 1.00
R7146:Cage1 UTSW 13 38023049 missense probably benign 0.03
R7192:Cage1 UTSW 13 38019244 missense probably benign
R7529:Cage1 UTSW 13 38025755 missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38022724 missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38022847 missense probably damaging 1.00
R7837:Cage1 UTSW 13 38022405 missense not run
Predicted Primers PCR Primer
(F):5'- GGAAATGCTACTTTCCACTGAAC -3'
(R):5'- GGCTATCTTGAGATCAATAGAAGATGC -3'

Sequencing Primer
(F):5'- AACTTTCTTCCTTAAATGGATCTGGC -3'
(R):5'- AACTGTAACAGTTGTTCTGT -3'
Posted On2015-03-18