Incidental Mutation 'R3757:Bmpr1a'
ID271494
Institutional Source Beutler Lab
Gene Symbol Bmpr1a
Ensembl Gene ENSMUSG00000021796
Gene Namebone morphogenetic protein receptor, type 1A
SynonymsBMPR-IA, 1110037I22Rik, Bmpr, ALK3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34410734-34503341 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 34434667 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 134 (L134*)
Ref Sequence ENSEMBL: ENSMUSP00000126852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049005] [ENSMUST00000165280] [ENSMUST00000171343]
Predicted Effect probably null
Transcript: ENSMUST00000049005
AA Change: L134*
SMART Domains Protein: ENSMUSP00000035900
Gene: ENSMUSG00000021796
AA Change: L134*

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 4.6e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165280
AA Change: L134*
SMART Domains Protein: ENSMUSP00000131984
Gene: ENSMUSG00000021796
AA Change: L134*

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 1.3e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171343
AA Change: L134*
SMART Domains Protein: ENSMUSP00000126852
Gene: ENSMUSG00000021796
AA Change: L134*

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 2e-15 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 9.5, are smaller than normal, and form no mesoderm; a conditional knockout resulted in gross malformations of the limbs with complete agenesis of the hindlimb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Bmpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Bmpr1a APN 14 34434419 missense probably benign
IGL03100:Bmpr1a APN 14 34441207 unclassified probably benign
R0329:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0330:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0411:Bmpr1a UTSW 14 34415877 missense possibly damaging 0.58
R0537:Bmpr1a UTSW 14 34443812 unclassified probably benign
R1707:Bmpr1a UTSW 14 34425141 splice site probably benign
R1767:Bmpr1a UTSW 14 34447770 critical splice donor site probably null
R1992:Bmpr1a UTSW 14 34425093 missense probably damaging 1.00
R4125:Bmpr1a UTSW 14 34434733 missense probably benign 0.35
R5320:Bmpr1a UTSW 14 34425042 missense probably damaging 1.00
R6956:Bmpr1a UTSW 14 34441175 missense possibly damaging 0.90
R7254:Bmpr1a UTSW 14 34414763 missense probably benign 0.03
R7267:Bmpr1a UTSW 14 34443879 missense possibly damaging 0.47
R7270:Bmpr1a UTSW 14 34441125 missense probably damaging 0.96
R8166:Bmpr1a UTSW 14 34425069 missense probably damaging 1.00
R8348:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
R8448:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGAGGACCAAAGTCAACAATAAGGT -3'
(R):5'- AATCACCAAAGTTCTTCATTCCTT -3'

Sequencing Primer
(F):5'- AGGTATAGTATCTTTCTGCTGCATC -3'
(R):5'- CTGGAGCTCACTTTGTAGACCAG -3'
Posted On2015-03-18