Incidental Mutation 'R3757:Dnajc28'
ID271501
Institutional Source Beutler Lab
Gene Symbol Dnajc28
Ensembl Gene ENSMUSG00000039763
Gene NameDnaJ heat shock protein family (Hsp40) member C28
SynonymsORF28
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3757 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91614254-91619026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91616867 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 187 (T187M)
Ref Sequence ENSEMBL: ENSMUSP00000132288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000049244] [ENSMUST00000133731] [ENSMUST00000143058] [ENSMUST00000156713] [ENSMUST00000169982] [ENSMUST00000232289] [ENSMUST00000232640]
Predicted Effect probably benign
Transcript: ENSMUST00000023684
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049244
AA Change: T163M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048113
Gene: ENSMUSG00000039763
AA Change: T163M

DomainStartEndE-ValueType
DnaJ 47 105 1.04e-11 SMART
low complexity region 112 123 N/A INTRINSIC
Pfam:DUF1992 203 342 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133731
SMART Domains Protein: ENSMUSP00000118526
Gene: ENSMUSG00000039763

DomainStartEndE-ValueType
DnaJ 47 84 6.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138207
Predicted Effect possibly damaging
Transcript: ENSMUST00000143058
AA Change: T187M

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120318
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169982
AA Change: T187M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132288
Gene: ENSMUSG00000039763
AA Change: T187M

DomainStartEndE-ValueType
DnaJ 71 129 1.04e-11 SMART
low complexity region 136 147 N/A INTRINSIC
Pfam:DUF1992 227 295 1.2e-24 PFAM
coiled coil region 312 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232620
Predicted Effect probably benign
Transcript: ENSMUST00000232640
Predicted Effect probably benign
Transcript: ENSMUST00000232643
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DnaJ heat shock protein family. The encoded protein, which contains a conserved N-terminal DnaJ domain, is thought to play a role in protein folding or act as a molecular chaperone protein. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,337,207 I9K probably benign Het
Arhgap31 T C 16: 38,637,000 E82G probably damaging Het
Asap2 T A 12: 21,267,766 S993T probably damaging Het
Bmpr1a A T 14: 34,434,667 L134* probably null Het
Cacna1e A G 1: 154,633,696 V271A probably damaging Het
Cacna2d4 A G 6: 119,241,163 E153G probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cdh24 T C 14: 54,632,180 D760G possibly damaging Het
Col9a1 T C 1: 24,232,231 probably null Het
Cts6 A T 13: 61,202,158 Y36* probably null Het
Dennd3 C G 15: 73,522,234 A36G probably benign Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Ep300 T A 15: 81,648,589 V1676E unknown Het
Ercc4 C T 16: 13,144,496 T668M probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10985 GCTCTCTCTCTCTCTCTCTCTCTCTCTCT GCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT 3: 53,845,224 probably null Het
Havcr1 G T 11: 46,752,580 R109L probably damaging Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Krtap4-9 A G 11: 99,785,618 probably benign Het
Layn T C 9: 51,059,556 E229G probably benign Het
Lpcat3 T A 6: 124,699,992 probably null Het
Lrrn1 T A 6: 107,569,208 F656I possibly damaging Het
Lypd1 A G 1: 125,910,384 probably benign Het
Olfr111 T A 17: 37,530,355 I126N probably damaging Het
Olfr1287 T A 2: 111,449,257 V39E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Rbm11 T C 16: 75,596,581 V55A probably damaging Het
Scn11a C T 9: 119,803,503 V434I probably benign Het
Serpinc1 A G 1: 161,002,365 T434A probably benign Het
Setd2 T C 9: 110,573,685 I1798T probably damaging Het
Sfswap A G 5: 129,513,234 Y265C probably damaging Het
Slc9a8 C A 2: 167,424,130 T9K probably benign Het
Synpo T C 18: 60,602,990 D389G probably damaging Het
Vmn1r181 C T 7: 23,984,484 L125F possibly damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Dnajc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Dnajc28 APN 16 91616441 missense possibly damaging 0.49
R1199:Dnajc28 UTSW 16 91618642 unclassified probably benign
R2265:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2266:Dnajc28 UTSW 16 91616312 missense probably benign 0.00
R2276:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2277:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2278:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2364:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2366:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2367:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R2447:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R3890:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4087:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4088:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4110:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4112:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R4113:Dnajc28 UTSW 16 91616867 missense probably damaging 1.00
R6372:Dnajc28 UTSW 16 91617288 missense probably benign 0.36
R6613:Dnajc28 UTSW 16 91616358 nonsense probably null
R8061:Dnajc28 UTSW 16 91617170 missense possibly damaging 0.70
R8163:Dnajc28 UTSW 16 91616907 nonsense probably null
R8165:Dnajc28 UTSW 16 91616907 nonsense probably null
R8172:Dnajc28 UTSW 16 91616907 nonsense probably null
R8174:Dnajc28 UTSW 16 91616907 nonsense probably null
Z1176:Dnajc28 UTSW 16 91617033 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CAGCCAGAAAATTTCTTCAGCG -3'
(R):5'- TGTCCCATGCGATAAAACGG -3'

Sequencing Primer
(F):5'- TTTCCCGCTGAGATTGTCAAAG -3'
(R):5'- TGCGATAAAACGGATGCATGCC -3'
Posted On2015-03-18