Incidental Mutation 'R3758:Tor1aip2'
ID271505
Institutional Source Beutler Lab
Gene Symbol Tor1aip2
Ensembl Gene ENSMUSG00000050565
Gene Nametorsin A interacting protein 2
Synonyms15kDa, Ifrg15, LULL1, 1110020D10Rik
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156035403-156068861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156065289 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 447 (E447G)
Ref Sequence ENSEMBL: ENSMUSP00000107387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060404] [ENSMUST00000111757]
Predicted Effect probably damaging
Transcript: ENSMUST00000060404
AA Change: E447G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050817
Gene: ENSMUSG00000050565
AA Change: E447G

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-222 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111757
AA Change: E447G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107387
Gene: ENSMUSG00000050565
AA Change: E447G

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125371
Meta Mutation Damage Score 0.5981 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Tor1aip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Tor1aip2 APN 1 156059539 missense probably benign 0.05
IGL02175:Tor1aip2 APN 1 156065006 missense probably damaging 0.96
IGL02328:Tor1aip2 APN 1 156064974 missense probably damaging 0.98
R0143:Tor1aip2 UTSW 1 156059548 missense probably benign 0.06
R1037:Tor1aip2 UTSW 1 156065336 missense probably benign 0.00
R1146:Tor1aip2 UTSW 1 156064737 missense possibly damaging 0.51
R1146:Tor1aip2 UTSW 1 156064737 missense possibly damaging 0.51
R1694:Tor1aip2 UTSW 1 156065285 missense probably benign
R1922:Tor1aip2 UTSW 1 156064794 missense probably damaging 1.00
R1955:Tor1aip2 UTSW 1 156051842 intron probably benign
R2131:Tor1aip2 UTSW 1 156065349 missense probably damaging 0.97
R4243:Tor1aip2 UTSW 1 156065436 missense probably damaging 0.98
R4583:Tor1aip2 UTSW 1 156065142 missense probably benign 0.01
R4678:Tor1aip2 UTSW 1 156065034 missense probably damaging 0.99
R5564:Tor1aip2 UTSW 1 156063561 unclassified probably benign
R6316:Tor1aip2 UTSW 1 156062094 missense probably damaging 0.99
R6713:Tor1aip2 UTSW 1 156065409 missense probably damaging 0.99
R6892:Tor1aip2 UTSW 1 156065181 missense possibly damaging 0.95
R7137:Tor1aip2 UTSW 1 156051976 missense possibly damaging 0.82
R8137:Tor1aip2 UTSW 1 156063668 missense possibly damaging 0.93
Z1176:Tor1aip2 UTSW 1 156052189 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACAGTGACACAGTCAAGCTG -3'
(R):5'- CTTCACAAAAGGCAGCCTCG -3'

Sequencing Primer
(F):5'- CGATGGGTTTGAGAATGGCCAC -3'
(R):5'- AAAGGCAGCCTCGCTCTTCTATG -3'
Posted On2015-03-18