Incidental Mutation 'R3758:Olfr1251'
ID271509
Institutional Source Beutler Lab
Gene Symbol Olfr1251
Ensembl Gene ENSMUSG00000111567
Gene Nameolfactory receptor 1251
SynonymsMOR231-15P, MOR231-24_p, GA_x6K02T2Q125-51109312-51108356
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89665870-89671936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89667572 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 105 (F105L)
Ref Sequence ENSEMBL: ENSMUSP00000150028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214304] [ENSMUST00000214639] [ENSMUST00000214750]
Predicted Effect probably benign
Transcript: ENSMUST00000099767
AA Change: F105L

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097355
Gene: ENSMUSG00000075077
AA Change: F105L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-45 PFAM
Pfam:7tm_1 39 285 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188085
AA Change: F105L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140591
Gene: ENSMUSG00000100323
AA Change: F105L

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 1.4e-29 PFAM
Pfam:7tm_4 137 278 2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214304
AA Change: F105L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214639
AA Change: F105L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000214750
AA Change: F105L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Olfr1251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Olfr1251 APN 2 89667004 missense probably benign 0.00
IGL01941:Olfr1251 APN 2 89667468 nonsense probably null 0.00
IGL01988:Olfr1251 APN 2 89667080 missense probably benign 0.07
IGL02388:Olfr1251 APN 2 89666972 missense probably benign 0.00
IGL03169:Olfr1251 APN 2 89667487 missense possibly damaging 0.86
R0008:Olfr1251 UTSW 2 89667084 missense probably damaging 1.00
R0042:Olfr1251 UTSW 2 89667454 missense probably benign 0.01
R0834:Olfr1251 UTSW 2 89667079 missense probably benign 0.24
R1102:Olfr1251 UTSW 2 89667470 missense probably damaging 0.98
R2213:Olfr1251 UTSW 2 89667547 missense probably damaging 1.00
R2219:Olfr1251 UTSW 2 89667867 missense possibly damaging 0.73
R3023:Olfr1251 UTSW 2 89667646 missense possibly damaging 0.86
R3105:Olfr1251 UTSW 2 89666958 missense probably benign 0.01
R3433:Olfr1251 UTSW 2 89667233 missense probably benign 0.01
R3508:Olfr1251 UTSW 2 89667472 missense probably benign 0.14
R3909:Olfr1251 UTSW 2 89667013 missense probably damaging 0.98
R4049:Olfr1251 UTSW 2 89667662 missense probably benign 0.03
R4457:Olfr1251 UTSW 2 89667083 missense probably benign 0.24
R5613:Olfr1251 UTSW 2 89667044 missense probably damaging 1.00
R5748:Olfr1251 UTSW 2 89667802 missense possibly damaging 0.67
R6226:Olfr1251 UTSW 2 89666989 missense probably damaging 1.00
R6950:Olfr1251 UTSW 2 89667551 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTGGTCAATGATATTGGGACC -3'
(R):5'- CTCATCGTAGGAACAGTGATTGC -3'

Sequencing Primer
(F):5'- TCAATGATATTGGGACCACAGAATG -3'
(R):5'- TAGGAACAGTGATTGCCAGCCC -3'
Posted On2015-03-18