Incidental Mutation 'R3758:Mill1'
ID271522
Institutional Source Beutler Lab
Gene Symbol Mill1
Ensembl Gene ENSMUSG00000054005
Gene NameMHC I like leukocyte 1
Synonyms5530400I18Rik
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location18245347-18266092 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 18262703 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066780]
Predicted Effect probably null
Transcript: ENSMUST00000066780
SMART Domains Protein: ENSMUSP00000069083
Gene: ENSMUSG00000054005

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:MHC_I 60 236 3.8e-33 PFAM
IGc1 255 327 3.53e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Mill1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Mill1 APN 7 18264641 missense possibly damaging 0.91
IGL01313:Mill1 APN 7 18264633 missense possibly damaging 0.82
IGL01417:Mill1 APN 7 18264783 missense probably benign 0.18
IGL01997:Mill1 APN 7 18255889 missense probably damaging 1.00
IGL02282:Mill1 APN 7 18263204 critical splice donor site probably null
IGL03126:Mill1 APN 7 18255907 missense probably benign 0.33
IGL03197:Mill1 APN 7 18264665 missense probably benign 0.02
R0513:Mill1 UTSW 7 18264877 nonsense probably null
R0515:Mill1 UTSW 7 18264873 missense probably benign 0.12
R1460:Mill1 UTSW 7 18262670 missense probably damaging 1.00
R1589:Mill1 UTSW 7 18245647 missense probably benign 0.01
R2192:Mill1 UTSW 7 18264619 nonsense probably null
R3704:Mill1 UTSW 7 18263053 missense possibly damaging 0.91
R4685:Mill1 UTSW 7 18255928 missense probably damaging 0.98
R4753:Mill1 UTSW 7 18262547 missense probably benign 0.28
R5763:Mill1 UTSW 7 18245662 missense probably benign 0.03
R5938:Mill1 UTSW 7 18262688 missense probably benign 0.00
R7757:Mill1 UTSW 7 18262466 missense probably benign 0.02
R8094:Mill1 UTSW 7 18255910 missense probably benign 0.01
Z1176:Mill1 UTSW 7 18245499 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTCGATGATGAGCCCTTCCTG -3'
(R):5'- CCCAGGCAATGACCTGTTATC -3'

Sequencing Primer
(F):5'- GATGAGCCCTTCCTGCCCTATAAG -3'
(R):5'- GACTTAATCTCTCAGTGGGGC -3'
Posted On2015-03-18