Incidental Mutation 'R3758:Nipa2'
ID271524
Institutional Source Beutler Lab
Gene Symbol Nipa2
Ensembl Gene ENSMUSG00000030452
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 2 homolog (human)
Synonyms
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55931287-55962476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55935941 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 102 (Y102C)
Ref Sequence ENSEMBL: ENSMUSP00000114020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000032635] [ENSMUST00000117812] [ENSMUST00000119041] [ENSMUST00000119201] [ENSMUST00000126604] [ENSMUST00000152649]
Predicted Effect probably benign
Transcript: ENSMUST00000032629
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032635
AA Change: Y102C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032635
Gene: ENSMUSG00000030452
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117812
AA Change: Y102C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113727
Gene: ENSMUSG00000030452
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 8 302 1.4e-151 PFAM
Pfam:EamA 47 128 4.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119041
AA Change: Y102C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112394
Gene: ENSMUSG00000030452
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119201
AA Change: Y102C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114020
Gene: ENSMUSG00000030452
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 306 3.2e-150 PFAM
Pfam:EmrE 16 135 6.2e-12 PFAM
Pfam:EamA 52 128 9.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126604
AA Change: Y102C

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116219
Gene: ENSMUSG00000030452
AA Change: Y102C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 130 1.2e-66 PFAM
Pfam:EmrE 14 130 1.8e-11 PFAM
Pfam:EamA 50 128 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147950
Predicted Effect probably damaging
Transcript: ENSMUST00000152649
AA Change: Y83C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120798
Gene: ENSMUSG00000030452
AA Change: Y83C

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 6 127 1.9e-53 PFAM
Pfam:EamA 10 109 1.8e-9 PFAM
Pfam:EmrE 18 116 1.1e-8 PFAM
Meta Mutation Damage Score 0.2664 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a possible magnesium transporter. This gene is located adjacent to the imprinted domain in the Prader-Willi syndrome deletion region of chromosome 15. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 7 and 21.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Nipa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Nipa2 APN 7 55933445 missense probably damaging 1.00
IGL01965:Nipa2 APN 7 55944623 start gained probably benign
IGL02373:Nipa2 APN 7 55933128 missense probably benign 0.01
IGL02812:Nipa2 APN 7 55943018 missense probably damaging 1.00
IGL03079:Nipa2 APN 7 55933457 missense probably damaging 1.00
IGL03188:Nipa2 APN 7 55932932 missense probably benign
R1327:Nipa2 UTSW 7 55944508 missense possibly damaging 0.81
R2356:Nipa2 UTSW 7 55932966 missense probably benign 0.00
R3870:Nipa2 UTSW 7 55932942 missense probably damaging 1.00
R4684:Nipa2 UTSW 7 55935826 missense probably benign
R4775:Nipa2 UTSW 7 55935863 missense probably benign 0.19
R5285:Nipa2 UTSW 7 55933012 nonsense probably null
R6453:Nipa2 UTSW 7 55935821 missense probably damaging 0.98
R6880:Nipa2 UTSW 7 55933251 missense probably damaging 0.99
R7459:Nipa2 UTSW 7 55933341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACACATGAGAACCATTTC -3'
(R):5'- TCTCAGTCAGATTGGTCAGGC -3'

Sequencing Primer
(F):5'- GAGAACCATTTCTTATAACCTGTGC -3'
(R):5'- CCTGCTAGTTGGATGCTCACAAATG -3'
Posted On2015-03-18