Mutagenetix > Incidental Mutations

Incidental Mutation 'R3758:Olfr582'

271525

Institutional Source

Beutler Lab

Gene Symbol

Olfr582

Ensembl Gene

ENSMUSG00000073961

Gene Name

olfactory receptor 582

Synonyms

GA_x6K02T2PBJ9-5752857-5753801, MOR30-3

MMRRC Submission

040739-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R3758 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103038024-103044040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103041970 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 159 (S159G)

Ref Sequence

ENSEMBL: ENSMUSP00000149453 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098212] [ENSMUST00000210119] [ENSMUST00000211036] [ENSMUST00000214021]

Predicted Effect

probably benign
Transcript: ENSMUST00000098212
AA Change: S164G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000095813
Gene: ENSMUSG00000073961
AA Change: S164G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	38	317	2.2e-109	PFAM
Pfam:7TM_GPCR_Srsx	42	179	1.6e-10	PFAM
Pfam:7tm_1	48	299	1.9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210119
AA Change: S159G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000211036
AA Change: S159G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

probably benign
Transcript: ENSMUST00000214021
AA Change: S159G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Meta Mutation Damage Score

0.0818

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

93% (28/30)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat3	A	G	17: 12,927,467		probably benign	Het
Bcat1	T	A	6: 145,032,872	I208F	probably damaging	Het
Cage1	A	C	13: 38,025,729	F91V	possibly damaging	Het
Cd200r3	T	G	16: 44,964,628		probably null	Het
Coq8b	C	T	7: 27,242,227	Q246*	probably null	Het
Dmxl1	G	A	18: 49,935,317	G2719D	probably damaging	Het
Fbln2	T	C	6: 91,256,381	S616P	probably damaging	Het
Fkbp10	G	A	11: 100,422,625		probably null	Het
Gabra1	G	T	11: 42,175,936	D50E	probably benign	Het
Hist1h1e	T	A	13: 23,622,257	K81*	probably null	Het
Hmgcs2	A	G	3: 98,291,090	N103S	probably damaging	Het
Htt	A	G	5: 34,895,970	H2549R	probably damaging	Het
Lrba	A	G	3: 86,776,049	E2726G	probably damaging	Het
Lrrc7	T	C	3: 158,163,965	N706D	probably damaging	Het
Mill1	G	A	7: 18,262,703		probably null	Het
Nipa2	T	C	7: 55,935,941	Y102C	probably damaging	Het
Nmd3	T	A	3: 69,724,308	C32*	probably null	Het
Olfr1251	A	G	2: 89,667,572	F105L	probably benign	Het
Olfr745	A	G	14: 50,643,036	K252E	possibly damaging	Het
Olfr777	T	C	10: 129,269,065	D86G	probably damaging	Het
Pcdhb7	A	G	18: 37,343,026	D405G	possibly damaging	Het
Ptprt	A	T	2: 161,812,030	L560Q	probably damaging	Het
Serpinb9b	A	G	13: 33,035,588	Y166C	probably damaging	Het
Soga1	T	C	2: 157,020,638	N1457S	possibly damaging	Het
Sprr1a	T	G	3: 92,484,397	K99T	probably damaging	Het
Spsb4	A	G	9: 96,995,871	V133A	probably damaging	Het
Suz12	A	G	11: 80,024,942	T391A	probably benign	Het
Tor1aip2	A	G	1: 156,065,289	E447G	probably damaging	Het
Ube4a	G	A	9: 44,949,900		probably benign	Het
Wdfy4	A	C	14: 33,023,374	H2296Q	probably benign	Het

Other mutations in Olfr582

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01946:Olfr582	APN	7	103042150	missense	probably damaging	1.00
IGL02236:Olfr582	APN	7	103041721	missense	possibly damaging	0.78
IGL02448:Olfr582	APN	7	103042397	missense	possibly damaging	0.84
IGL03056:Olfr582	APN	7	103041751	missense	possibly damaging	0.87
IGL03351:Olfr582	APN	7	103042130	missense	probably damaging	1.00
IGL03368:Olfr582	APN	7	103041765	missense	possibly damaging	0.93
R1762:Olfr582	UTSW	7	103042042	missense	probably damaging	1.00
R2027:Olfr582	UTSW	7	103041524	missense	probably benign	0.36
R4668:Olfr582	UTSW	7	103041851	missense	probably benign
R5568:Olfr582	UTSW	7	103042310	missense	possibly damaging	0.72
R5573:Olfr582	UTSW	7	103042340	missense	probably damaging	1.00
R6005:Olfr582	UTSW	7	103041646	missense	probably damaging	0.98
R7112:Olfr582	UTSW	7	103041655	missense	probably damaging	0.98
R7223:Olfr582	UTSW	7	103041632	missense	possibly damaging	0.65
R7875:Olfr582	UTSW	7	103041853	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATATCATGCCTGCCTCATCC -3'
(R):5'- AGCACAGCTCTCAGAATCATTG -3'

Sequencing Primer
(F):5'- ATCCAGGTGTTCTTCATACATGC -3'
(R):5'- CAGCTCTCAGAATCATTGCATAAG -3'

Posted On

2015-03-18