Incidental Mutation 'R3758:Olfr582'
ID271525
Institutional Source Beutler Lab
Gene Symbol Olfr582
Ensembl Gene ENSMUSG00000073961
Gene Nameolfactory receptor 582
SynonymsGA_x6K02T2PBJ9-5752857-5753801, MOR30-3
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103038024-103044040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103041970 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 159 (S159G)
Ref Sequence ENSEMBL: ENSMUSP00000149453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098212] [ENSMUST00000210119] [ENSMUST00000211036] [ENSMUST00000214021]
Predicted Effect probably benign
Transcript: ENSMUST00000098212
AA Change: S164G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095813
Gene: ENSMUSG00000073961
AA Change: S164G

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 2.2e-109 PFAM
Pfam:7TM_GPCR_Srsx 42 179 1.6e-10 PFAM
Pfam:7tm_1 48 299 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210119
AA Change: S159G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000211036
AA Change: S159G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214021
AA Change: S159G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Olfr582
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Olfr582 APN 7 103042150 missense probably damaging 1.00
IGL02236:Olfr582 APN 7 103041721 missense possibly damaging 0.78
IGL02448:Olfr582 APN 7 103042397 missense possibly damaging 0.84
IGL03056:Olfr582 APN 7 103041751 missense possibly damaging 0.87
IGL03351:Olfr582 APN 7 103042130 missense probably damaging 1.00
IGL03368:Olfr582 APN 7 103041765 missense possibly damaging 0.93
R1762:Olfr582 UTSW 7 103042042 missense probably damaging 1.00
R2027:Olfr582 UTSW 7 103041524 missense probably benign 0.36
R4668:Olfr582 UTSW 7 103041851 missense probably benign
R5568:Olfr582 UTSW 7 103042310 missense possibly damaging 0.72
R5573:Olfr582 UTSW 7 103042340 missense probably damaging 1.00
R6005:Olfr582 UTSW 7 103041646 missense probably damaging 0.98
R7112:Olfr582 UTSW 7 103041655 missense probably damaging 0.98
R7223:Olfr582 UTSW 7 103041632 missense possibly damaging 0.65
R7875:Olfr582 UTSW 7 103041853 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATATCATGCCTGCCTCATCC -3'
(R):5'- AGCACAGCTCTCAGAATCATTG -3'

Sequencing Primer
(F):5'- ATCCAGGTGTTCTTCATACATGC -3'
(R):5'- CAGCTCTCAGAATCATTGCATAAG -3'
Posted On2015-03-18