Incidental Mutation 'R3758:Ube4a'
ID271526
Institutional Source Beutler Lab
Gene Symbol Ube4a
Ensembl Gene ENSMUSG00000059890
Gene Nameubiquitination factor E4A
Synonyms9930123J21Rik, UFD2b, 4732444G18Rik
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44923127-44965600 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 44949900 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000125642] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213666] [ENSMUST00000213890] [ENSMUST00000214761]
Predicted Effect probably benign
Transcript: ENSMUST00000117506
SMART Domains Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 288 299 N/A INTRINSIC
Pfam:Ufd2P_core 330 766 2.6e-101 PFAM
Pfam:Ufd2P_core 762 935 7.4e-61 PFAM
Ubox 953 1016 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117549
SMART Domains Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 991 3.4e-155 PFAM
Ubox 1010 1073 1.9e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125642
Predicted Effect probably benign
Transcript: ENSMUST00000138559
Predicted Effect probably benign
Transcript: ENSMUST00000145657
Predicted Effect probably benign
Transcript: ENSMUST00000154287
SMART Domains Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

DomainStartEndE-ValueType
low complexity region 307 318 N/A INTRINSIC
Pfam:Ufd2P_core 349 547 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213193
Predicted Effect probably benign
Transcript: ENSMUST00000213666
Predicted Effect probably benign
Transcript: ENSMUST00000213890
Predicted Effect probably benign
Transcript: ENSMUST00000214761
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Ube4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ube4a APN 9 44948141 missense probably damaging 1.00
IGL00857:Ube4a APN 9 44932386 missense probably damaging 1.00
IGL01067:Ube4a APN 9 44944865 missense probably damaging 0.96
White_way UTSW 9 44949753 nonsense probably null
R0243:Ube4a UTSW 9 44946178 unclassified probably benign
R0355:Ube4a UTSW 9 44944801 splice site probably benign
R0680:Ube4a UTSW 9 44948060 missense probably damaging 1.00
R0863:Ube4a UTSW 9 44949816 missense possibly damaging 0.55
R0909:Ube4a UTSW 9 44939973 missense probably damaging 0.97
R1597:Ube4a UTSW 9 44929766 missense possibly damaging 0.93
R1611:Ube4a UTSW 9 44956737 intron probably benign
R1871:Ube4a UTSW 9 44944937 splice site probably null
R2069:Ube4a UTSW 9 44948099 missense probably damaging 0.96
R2518:Ube4a UTSW 9 44948137 missense probably benign 0.29
R3079:Ube4a UTSW 9 44960073 missense probably damaging 1.00
R3404:Ube4a UTSW 9 44929687 missense probably damaging 1.00
R3726:Ube4a UTSW 9 44933323 missense probably damaging 0.97
R4027:Ube4a UTSW 9 44949900 unclassified probably benign
R4029:Ube4a UTSW 9 44949900 unclassified probably benign
R4111:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4113:Ube4a UTSW 9 44948949 missense probably damaging 0.97
R4238:Ube4a UTSW 9 44939999 missense probably damaging 1.00
R4365:Ube4a UTSW 9 44960081 missense probably damaging 1.00
R4471:Ube4a UTSW 9 44946532 unclassified probably benign
R4793:Ube4a UTSW 9 44948822 missense probably damaging 1.00
R5069:Ube4a UTSW 9 44940089 missense probably damaging 1.00
R5214:Ube4a UTSW 9 44948868 missense probably benign 0.22
R5225:Ube4a UTSW 9 44939960 critical splice donor site probably null
R5416:Ube4a UTSW 9 44941178 missense probably damaging 0.99
R5641:Ube4a UTSW 9 44950881 missense probably damaging 0.99
R5729:Ube4a UTSW 9 44933329 missense probably damaging 1.00
R5774:Ube4a UTSW 9 44953097 missense probably damaging 0.99
R5908:Ube4a UTSW 9 44948024 critical splice donor site probably null
R6191:Ube4a UTSW 9 44949753 nonsense probably null
R6752:Ube4a UTSW 9 44925948 missense probably damaging 1.00
R6886:Ube4a UTSW 9 44948843 missense probably damaging 0.96
R6911:Ube4a UTSW 9 44942758 missense probably damaging 1.00
R7417:Ube4a UTSW 9 44956713 missense probably benign 0.08
R7650:Ube4a UTSW 9 44933436 missense probably damaging 0.99
R7747:Ube4a UTSW 9 44925973 missense probably damaging 1.00
R7798:Ube4a UTSW 9 44933331 missense probably damaging 1.00
R7842:Ube4a UTSW 9 44949727 splice site probably null
R7853:Ube4a UTSW 9 44953010 missense probably benign 0.43
R8109:Ube4a UTSW 9 44935483 missense probably benign 0.00
R8223:Ube4a UTSW 9 44960035 missense possibly damaging 0.94
R8401:Ube4a UTSW 9 44941229 missense possibly damaging 0.84
X0025:Ube4a UTSW 9 44942818 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GCTTCTATACTCACGGGCTC -3'
(R):5'- GTCAGGAATTTTCAGTCCCCAAG -3'

Sequencing Primer
(F):5'- TATACTCACGGGCTCCCTGAATAG -3'
(R):5'- ATTTTATCCCAGCACTCAGGAGG -3'
Posted On2015-03-18