Mutagenetix > Incidental Mutations

Incidental Mutation 'R3758:Ube4a'

271526

Institutional Source

Beutler Lab

Gene Symbol

Ube4a

Ensembl Gene

ENSMUSG00000059890

Gene Name

ubiquitination factor E4A

Synonyms

9930123J21Rik, UFD2b, 4732444G18Rik

MMRRC Submission

040739-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3758 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44923127-44965600 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 44949900 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117506] [ENSMUST00000117549] [ENSMUST00000125642] [ENSMUST00000138559] [ENSMUST00000145657] [ENSMUST00000154287] [ENSMUST00000213193] [ENSMUST00000213666] [ENSMUST00000213890] [ENSMUST00000214761]

Predicted Effect

probably benign
Transcript: ENSMUST00000117506

SMART Domains

Protein: ENSMUSP00000113346
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	288	299	N/A	INTRINSIC
Pfam:Ufd2P_core	330	766	2.6e-101	PFAM
Pfam:Ufd2P_core	762	935	7.4e-61	PFAM
Ubox	953	1016	1.9e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117549

SMART Domains

Protein: ENSMUSP00000112632
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	991	3.4e-155	PFAM
Ubox	1010	1073	1.9e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125642

Predicted Effect

probably benign
Transcript: ENSMUST00000138559

Predicted Effect

probably benign
Transcript: ENSMUST00000145657

Predicted Effect

probably benign
Transcript: ENSMUST00000154287

SMART Domains

Protein: ENSMUSP00000123668
Gene: ENSMUSG00000059890

Domain	Start	End	E-Value	Type
low complexity region	307	318	N/A	INTRINSIC
Pfam:Ufd2P_core	349	547	4.1e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000213193

Predicted Effect

probably benign
Transcript: ENSMUST00000213666

Predicted Effect

probably benign
Transcript: ENSMUST00000213890

Predicted Effect

probably benign
Transcript: ENSMUST00000214761

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

93% (28/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the U-box ubiquitin ligase family. The encoded protein is involved in multiubiquitin chain assembly and plays a critical role in chromosome condensation and separation through the polyubiquitination of securin. Autoantibodies against the encoded protein may be markers for scleroderma and Crohn's disease. A pseudogene of this gene is located on the long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat3	A	G	17: 12,927,467		probably benign	Het
Bcat1	T	A	6: 145,032,872	I208F	probably damaging	Het
Cage1	A	C	13: 38,025,729	F91V	possibly damaging	Het
Cd200r3	T	G	16: 44,964,628		probably null	Het
Coq8b	C	T	7: 27,242,227	Q246*	probably null	Het
Dmxl1	G	A	18: 49,935,317	G2719D	probably damaging	Het
Fbln2	T	C	6: 91,256,381	S616P	probably damaging	Het
Fkbp10	G	A	11: 100,422,625		probably null	Het
Gabra1	G	T	11: 42,175,936	D50E	probably benign	Het
Hist1h1e	T	A	13: 23,622,257	K81*	probably null	Het
Hmgcs2	A	G	3: 98,291,090	N103S	probably damaging	Het
Htt	A	G	5: 34,895,970	H2549R	probably damaging	Het
Lrba	A	G	3: 86,776,049	E2726G	probably damaging	Het
Lrrc7	T	C	3: 158,163,965	N706D	probably damaging	Het
Mill1	G	A	7: 18,262,703		probably null	Het
Nipa2	T	C	7: 55,935,941	Y102C	probably damaging	Het
Nmd3	T	A	3: 69,724,308	C32*	probably null	Het
Olfr1251	A	G	2: 89,667,572	F105L	probably benign	Het
Olfr582	A	G	7: 103,041,970	S159G	probably benign	Het
Olfr745	A	G	14: 50,643,036	K252E	possibly damaging	Het
Olfr777	T	C	10: 129,269,065	D86G	probably damaging	Het
Pcdhb7	A	G	18: 37,343,026	D405G	possibly damaging	Het
Ptprt	A	T	2: 161,812,030	L560Q	probably damaging	Het
Serpinb9b	A	G	13: 33,035,588	Y166C	probably damaging	Het
Soga1	T	C	2: 157,020,638	N1457S	possibly damaging	Het
Sprr1a	T	G	3: 92,484,397	K99T	probably damaging	Het
Spsb4	A	G	9: 96,995,871	V133A	probably damaging	Het
Suz12	A	G	11: 80,024,942	T391A	probably benign	Het
Tor1aip2	A	G	1: 156,065,289	E447G	probably damaging	Het
Wdfy4	A	C	14: 33,023,374	H2296Q	probably benign	Het

Other mutations in Ube4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Ube4a	APN	9	44948141	missense	probably damaging	1.00
IGL00857:Ube4a	APN	9	44932386	missense	probably damaging	1.00
IGL01067:Ube4a	APN	9	44944865	missense	probably damaging	0.96
White_way	UTSW	9	44949753	nonsense	probably null
R0243:Ube4a	UTSW	9	44946178	unclassified	probably benign
R0355:Ube4a	UTSW	9	44944801	splice site	probably benign
R0680:Ube4a	UTSW	9	44948060	missense	probably damaging	1.00
R0863:Ube4a	UTSW	9	44949816	missense	possibly damaging	0.55
R0909:Ube4a	UTSW	9	44939973	missense	probably damaging	0.97
R1597:Ube4a	UTSW	9	44929766	missense	possibly damaging	0.93
R1611:Ube4a	UTSW	9	44956737	intron	probably benign
R1871:Ube4a	UTSW	9	44944937	splice site	probably null
R2069:Ube4a	UTSW	9	44948099	missense	probably damaging	0.96
R2518:Ube4a	UTSW	9	44948137	missense	probably benign	0.29
R3079:Ube4a	UTSW	9	44960073	missense	probably damaging	1.00
R3404:Ube4a	UTSW	9	44929687	missense	probably damaging	1.00
R3726:Ube4a	UTSW	9	44933323	missense	probably damaging	0.97
R4027:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4029:Ube4a	UTSW	9	44949900	unclassified	probably benign
R4111:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4113:Ube4a	UTSW	9	44948949	missense	probably damaging	0.97
R4238:Ube4a	UTSW	9	44939999	missense	probably damaging	1.00
R4365:Ube4a	UTSW	9	44960081	missense	probably damaging	1.00
R4471:Ube4a	UTSW	9	44946532	unclassified	probably benign
R4793:Ube4a	UTSW	9	44948822	missense	probably damaging	1.00
R5069:Ube4a	UTSW	9	44940089	missense	probably damaging	1.00
R5214:Ube4a	UTSW	9	44948868	missense	probably benign	0.22
R5225:Ube4a	UTSW	9	44939960	critical splice donor site	probably null
R5416:Ube4a	UTSW	9	44941178	missense	probably damaging	0.99
R5641:Ube4a	UTSW	9	44950881	missense	probably damaging	0.99
R5729:Ube4a	UTSW	9	44933329	missense	probably damaging	1.00
R5774:Ube4a	UTSW	9	44953097	missense	probably damaging	0.99
R5908:Ube4a	UTSW	9	44948024	critical splice donor site	probably null
R6191:Ube4a	UTSW	9	44949753	nonsense	probably null
R6752:Ube4a	UTSW	9	44925948	missense	probably damaging	1.00
R6886:Ube4a	UTSW	9	44948843	missense	probably damaging	0.96
R6911:Ube4a	UTSW	9	44942758	missense	probably damaging	1.00
R7417:Ube4a	UTSW	9	44956713	missense	probably benign	0.08
R7650:Ube4a	UTSW	9	44933436	missense	probably damaging	0.99
R7747:Ube4a	UTSW	9	44925973	missense	probably damaging	1.00
R7798:Ube4a	UTSW	9	44933331	missense	probably damaging	1.00
R7842:Ube4a	UTSW	9	44949727	splice site	probably null
R7853:Ube4a	UTSW	9	44953010	missense	probably benign	0.43
R8109:Ube4a	UTSW	9	44935483	missense	probably benign	0.00
R8223:Ube4a	UTSW	9	44960035	missense	possibly damaging	0.94
R8401:Ube4a	UTSW	9	44941229	missense	possibly damaging	0.84
X0025:Ube4a	UTSW	9	44942818	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- GCTTCTATACTCACGGGCTC -3'
(R):5'- GTCAGGAATTTTCAGTCCCCAAG -3'

Sequencing Primer
(F):5'- TATACTCACGGGCTCCCTGAATAG -3'
(R):5'- ATTTTATCCCAGCACTCAGGAGG -3'

Posted On

2015-03-18