Incidental Mutation 'R3758:Spsb4'
ID271527
Institutional Source Beutler Lab
Gene Symbol Spsb4
Ensembl Gene ENSMUSG00000046997
Gene NamesplA/ryanodine receptor domain and SOCS box containing 4
SynonymsD030068E18Rik, Ssb4
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3758 (G1)
Quality Score135
Status Validated
Chromosome9
Chromosomal Location96943482-97018843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96995871 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000057849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055433]
Predicted Effect probably damaging
Transcript: ENSMUST00000055433
AA Change: V133A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057849
Gene: ENSMUSG00000046997
AA Change: V133A

DomainStartEndE-ValueType
SPRY 95 230 5.67e-19 SMART
SOCS_box 234 273 3.41e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064445
Meta Mutation Damage Score 0.4474 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Spsb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Spsb4 APN 9 96944593 missense probably benign 0.01
IGL01582:Spsb4 APN 9 96996090 missense probably damaging 1.00
R0320:Spsb4 UTSW 9 96996108 missense probably damaging 1.00
R1664:Spsb4 UTSW 9 96996213 missense possibly damaging 0.88
R2495:Spsb4 UTSW 9 96995787 missense probably damaging 1.00
R2872:Spsb4 UTSW 9 96996018 missense probably damaging 1.00
R2872:Spsb4 UTSW 9 96996018 missense probably damaging 1.00
R2874:Spsb4 UTSW 9 96996018 missense probably damaging 1.00
R4604:Spsb4 UTSW 9 96995878 missense probably benign 0.00
R4678:Spsb4 UTSW 9 96995691 missense probably damaging 0.98
R5532:Spsb4 UTSW 9 96995574 critical splice donor site probably null
R6157:Spsb4 UTSW 9 96996107 missense probably damaging 1.00
R6368:Spsb4 UTSW 9 96944645 missense probably benign 0.01
R7787:Spsb4 UTSW 9 96995590 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATCCACGATGAAGCTGAG -3'
(R):5'- GCTCCCTCAATGTCTTTGTCAAGG -3'

Sequencing Primer
(F):5'- ATGAAGCTGAGCGTGCC -3'
(R):5'- TCAAGGATGACGACCGCCTC -3'
Posted On2015-03-18