Incidental Mutation 'R3758:Gabra1'
ID271529
Institutional Source Beutler Lab
Gene Symbol Gabra1
Ensembl Gene ENSMUSG00000010803
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 1
SynonymsGabra-1, GABAAR alpha1, GABAA alpha 1
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location42130939-42182930 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42175936 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000147186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020707] [ENSMUST00000132971] [ENSMUST00000153147] [ENSMUST00000205546] [ENSMUST00000206085] [ENSMUST00000206105] [ENSMUST00000207274]
Predicted Effect probably benign
Transcript: ENSMUST00000020707
AA Change: D50E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020707
Gene: ENSMUSG00000010803
AA Change: D50E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Neur_chan_LBD 41 249 1.5e-52 PFAM
Pfam:Neur_chan_memb 256 347 8.6e-33 PFAM
low complexity region 395 411 N/A INTRINSIC
transmembrane domain 420 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132971
SMART Domains Protein: ENSMUSP00000126611
Gene: ENSMUSG00000010803

DomainStartEndE-ValueType
low complexity region 50 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153147
AA Change: D50E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000129056
Gene: ENSMUSG00000010803
AA Change: D50E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1i9ba_ 46 84 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169305
Predicted Effect probably benign
Transcript: ENSMUST00000205546
AA Change: D50E

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000206085
Predicted Effect probably benign
Transcript: ENSMUST00000206105
AA Change: D50E

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000207274
AA Change: D50E

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knockout alleles or ones with various nucleotide substitutions exhibit altered life span, abnormal response to benzodiazepines and imidazopyridines, abnormal behaviors and abnormal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Gabra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Gabra1 APN 11 42133626 missense probably benign 0.06
IGL01645:Gabra1 APN 11 42135562 missense probably damaging 1.00
IGL01893:Gabra1 APN 11 42133759 missense possibly damaging 0.80
IGL02114:Gabra1 APN 11 42135575 missense probably damaging 1.00
IGL02378:Gabra1 APN 11 42140255 missense probably damaging 1.00
IGL03402:Gabra1 APN 11 42133518 missense probably damaging 0.96
opulence UTSW 11 42162555 missense probably benign 0.08
Splendor UTSW 11 42135443 missense possibly damaging 0.94
R0546:Gabra1 UTSW 11 42162601 missense probably damaging 0.96
R1495:Gabra1 UTSW 11 42154944 missense probably damaging 1.00
R1538:Gabra1 UTSW 11 42140350 missense probably benign 0.19
R1850:Gabra1 UTSW 11 42179576 missense probably benign
R1989:Gabra1 UTSW 11 42155015 missense probably damaging 1.00
R2061:Gabra1 UTSW 11 42133798 unclassified probably benign
R4781:Gabra1 UTSW 11 42133661 missense probably damaging 0.98
R4788:Gabra1 UTSW 11 42147153 missense probably damaging 1.00
R5215:Gabra1 UTSW 11 42154828 missense probably damaging 1.00
R5306:Gabra1 UTSW 11 42133552 missense probably benign 0.00
R5655:Gabra1 UTSW 11 42182923 splice site probably null
R5789:Gabra1 UTSW 11 42182915 unclassified probably benign
R6273:Gabra1 UTSW 11 42140311 missense probably damaging 0.99
R6289:Gabra1 UTSW 11 42155019 missense probably damaging 0.97
R6298:Gabra1 UTSW 11 42182378 unclassified probably benign
R6475:Gabra1 UTSW 11 42162555 missense probably benign 0.08
R6552:Gabra1 UTSW 11 42147099 missense probably damaging 0.99
R7338:Gabra1 UTSW 11 42182294 missense unknown
R7405:Gabra1 UTSW 11 42155023 missense probably damaging 1.00
R7515:Gabra1 UTSW 11 42154833 missense possibly damaging 0.95
R7725:Gabra1 UTSW 11 42135443 missense possibly damaging 0.94
R7727:Gabra1 UTSW 11 42133591 missense probably damaging 1.00
R8193:Gabra1 UTSW 11 42147141 missense probably damaging 1.00
R8319:Gabra1 UTSW 11 42135488 missense probably damaging 1.00
R8362:Gabra1 UTSW 11 42176004 missense probably benign 0.15
X0066:Gabra1 UTSW 11 42133738 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTGAACTAGCACTGAGTGGAC -3'
(R):5'- CTGTGCTGAGAGCTGAAAAC -3'

Sequencing Primer
(F):5'- AGCACTGAGTGGACTATTAAAATATG -3'
(R):5'- TTCAAACTCCCAATAGCAAGTTAAG -3'
Posted On2015-03-18