Incidental Mutation 'R3758:Cage1'
ID271534
Institutional Source Beutler Lab
Gene Symbol Cage1
Ensembl Gene ENSMUSG00000044566
Gene Namecancer antigen 1
SynonymsCtag3, 4933427I01Rik, CAGE1
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38006052-38037069 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38025729 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 91 (F91V)
Ref Sequence ENSEMBL: ENSMUSP00000122393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074969] [ENSMUST00000089840] [ENSMUST00000110233] [ENSMUST00000131066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074969
AA Change: F91V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074499
Gene: ENSMUSG00000044566
AA Change: F91V

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 5.1e-292 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089840
SMART Domains Protein: ENSMUSP00000087278
Gene: ENSMUSG00000044566

DomainStartEndE-ValueType
Pfam:CAGE1 1 420 6.8e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110233
AA Change: F91V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105862
Gene: ENSMUSG00000044566
AA Change: F91V

DomainStartEndE-ValueType
Pfam:CAGE1 1 526 2.4e-255 PFAM
low complexity region 664 682 N/A INTRINSIC
coiled coil region 778 811 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131066
AA Change: F91V

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122393
Gene: ENSMUSG00000044566
AA Change: F91V

DomainStartEndE-ValueType
Pfam:CAGE1 1 318 6.5e-167 PFAM
Meta Mutation Damage Score 0.1466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Cage1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Cage1 APN 13 38022993 nonsense probably null
IGL01736:Cage1 APN 13 38022813 missense possibly damaging 0.93
IGL02149:Cage1 APN 13 38022529 missense probably damaging 1.00
IGL02267:Cage1 APN 13 38023257 missense probably damaging 1.00
IGL03030:Cage1 APN 13 38028147 missense probably benign
IGL03216:Cage1 APN 13 38006177 splice site probably benign
R0487:Cage1 UTSW 13 38025358 missense probably benign 0.00
R0606:Cage1 UTSW 13 38016494 splice site probably benign
R1015:Cage1 UTSW 13 38016475 missense possibly damaging 0.96
R1170:Cage1 UTSW 13 38022880 missense probably damaging 1.00
R1400:Cage1 UTSW 13 38032424 missense possibly damaging 0.86
R1721:Cage1 UTSW 13 38023333 nonsense probably null
R2057:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2058:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2059:Cage1 UTSW 13 38023380 missense probably benign 0.04
R2197:Cage1 UTSW 13 38023053 missense probably damaging 1.00
R3757:Cage1 UTSW 13 38025729 missense possibly damaging 0.71
R4041:Cage1 UTSW 13 38019177 missense possibly damaging 0.96
R4370:Cage1 UTSW 13 38025650 missense probably damaging 1.00
R4401:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4402:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4403:Cage1 UTSW 13 38023102 missense probably damaging 1.00
R4490:Cage1 UTSW 13 38023417 missense possibly damaging 0.86
R4621:Cage1 UTSW 13 38025501 missense possibly damaging 0.85
R4921:Cage1 UTSW 13 38019208 missense probably benign 0.33
R4950:Cage1 UTSW 13 38023326 missense possibly damaging 0.55
R4953:Cage1 UTSW 13 38023430 missense possibly damaging 0.51
R5023:Cage1 UTSW 13 38011411 nonsense probably null
R5808:Cage1 UTSW 13 38022325 unclassified probably benign
R5845:Cage1 UTSW 13 38015706 missense probably damaging 0.96
R6278:Cage1 UTSW 13 38016419 missense possibly damaging 0.53
R6503:Cage1 UTSW 13 38025449 missense possibly damaging 0.73
R6882:Cage1 UTSW 13 38022558 missense probably damaging 1.00
R7146:Cage1 UTSW 13 38023049 missense probably benign 0.03
R7192:Cage1 UTSW 13 38019244 missense probably benign
R7529:Cage1 UTSW 13 38025755 missense possibly damaging 0.71
R7580:Cage1 UTSW 13 38022724 missense possibly damaging 0.90
R7646:Cage1 UTSW 13 38022847 missense probably damaging 1.00
R7837:Cage1 UTSW 13 38022405 missense not run
R8355:Cage1 UTSW 13 38019249 missense probably damaging 0.99
R8435:Cage1 UTSW 13 38019185 missense possibly damaging 0.73
R8466:Cage1 UTSW 13 38023011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGAACTTTCTTCCTTAAATGG -3'
(R):5'- ATCATGAGTTTGAGGCTATCTTGAG -3'

Sequencing Primer
(F):5'- AAATGGATCTGGCTTTTCACTGC -3'
(R):5'- TGAGGCTATCTTGAGATCAATAGAAG -3'
Posted On2015-03-18