Mutagenetix > Incidental Mutations

Incidental Mutation 'R3758:Olfr745'

271536

Institutional Source

Beutler Lab

Gene Symbol

Olfr745

Ensembl Gene

ENSMUSG00000050028

Gene Name

olfactory receptor 745

Synonyms

GA_x6K02T2PMLR-6361495-6362481, MOR106-11

MMRRC Submission

040739-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R3758 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50639388-50643885 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50643036 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 252 (K252E)

Ref Sequence

ENSEMBL: ENSMUSP00000050184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062534] [ENSMUST00000213127] [ENSMUST00000218546]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062534
AA Change: K252E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000050184
Gene: ENSMUSG00000050028
AA Change: K252E

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:7tm_4	44	324	6.3e-54	PFAM
Pfam:7TM_GPCR_Srsx	51	191	6.6e-6	PFAM
Pfam:7tm_1	57	306	1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206749

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213127
AA Change: K246E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216105

Predicted Effect

probably benign
Transcript: ENSMUST00000218546

Meta Mutation Damage Score

0.4367

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.1%

Validation Efficiency

93% (28/30)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat3	A	G	17: 12,927,467		probably benign	Het
Bcat1	T	A	6: 145,032,872	I208F	probably damaging	Het
Cage1	A	C	13: 38,025,729	F91V	possibly damaging	Het
Cd200r3	T	G	16: 44,964,628		probably null	Het
Coq8b	C	T	7: 27,242,227	Q246*	probably null	Het
Dmxl1	G	A	18: 49,935,317	G2719D	probably damaging	Het
Fbln2	T	C	6: 91,256,381	S616P	probably damaging	Het
Fkbp10	G	A	11: 100,422,625		probably null	Het
Gabra1	G	T	11: 42,175,936	D50E	probably benign	Het
Hist1h1e	T	A	13: 23,622,257	K81*	probably null	Het
Hmgcs2	A	G	3: 98,291,090	N103S	probably damaging	Het
Htt	A	G	5: 34,895,970	H2549R	probably damaging	Het
Lrba	A	G	3: 86,776,049	E2726G	probably damaging	Het
Lrrc7	T	C	3: 158,163,965	N706D	probably damaging	Het
Mill1	G	A	7: 18,262,703		probably null	Het
Nipa2	T	C	7: 55,935,941	Y102C	probably damaging	Het
Nmd3	T	A	3: 69,724,308	C32*	probably null	Het
Olfr1251	A	G	2: 89,667,572	F105L	probably benign	Het
Olfr582	A	G	7: 103,041,970	S159G	probably benign	Het
Olfr777	T	C	10: 129,269,065	D86G	probably damaging	Het
Pcdhb7	A	G	18: 37,343,026	D405G	possibly damaging	Het
Ptprt	A	T	2: 161,812,030	L560Q	probably damaging	Het
Serpinb9b	A	G	13: 33,035,588	Y166C	probably damaging	Het
Soga1	T	C	2: 157,020,638	N1457S	possibly damaging	Het
Sprr1a	T	G	3: 92,484,397	K99T	probably damaging	Het
Spsb4	A	G	9: 96,995,871	V133A	probably damaging	Het
Suz12	A	G	11: 80,024,942	T391A	probably benign	Het
Tor1aip2	A	G	1: 156,065,289	E447G	probably damaging	Het
Ube4a	G	A	9: 44,949,900		probably benign	Het
Wdfy4	A	C	14: 33,023,374	H2296Q	probably benign	Het

Other mutations in Olfr745

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Olfr745	APN	14	50643168	missense	probably benign	0.02
IGL02316:Olfr745	APN	14	50642287	missense	probably benign	0.25
IGL02377:Olfr745	APN	14	50642518	splice site	probably null
IGL02471:Olfr745	APN	14	50642757	missense	probably benign	0.43
IGL02486:Olfr745	APN	14	50642632	missense	probably damaging	1.00
IGL02517:Olfr745	APN	14	50643201	missense	probably benign	0.01
R0453:Olfr745	UTSW	14	50643004	missense	possibly damaging	0.90
R0727:Olfr745	UTSW	14	50643003	missense	probably damaging	0.98
R0746:Olfr745	UTSW	14	50642775	splice site	probably null
R1638:Olfr745	UTSW	14	50643108	missense	possibly damaging	0.93
R1688:Olfr745	UTSW	14	50643248	missense	probably benign	0.04
R1991:Olfr745	UTSW	14	50642866	missense	possibly damaging	0.90
R2245:Olfr745	UTSW	14	50642605	missense	probably damaging	1.00
R4084:Olfr745	UTSW	14	50642848	missense	probably damaging	0.98
R5033:Olfr745	UTSW	14	50643162	missense	probably damaging	1.00
R5211:Olfr745	UTSW	14	50643253	missense	possibly damaging	0.78
R5302:Olfr745	UTSW	14	50642319	splice site	probably null
R5645:Olfr745	UTSW	14	50643067	missense	probably benign	0.00
R5731:Olfr745	UTSW	14	50642791	missense	probably damaging	1.00
R6917:Olfr745	UTSW	14	50643223	missense	possibly damaging	0.67
R7408:Olfr745	UTSW	14	50642395	missense	probably benign	0.16
R7716:Olfr745	UTSW	14	50642358	missense	probably benign	0.17
R7728:Olfr745	UTSW	14	50642392	missense	probably benign	0.00
R8208:Olfr745	UTSW	14	50642631	missense	probably benign	0.28
R8447:Olfr745	UTSW	14	50642551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCAGGACCATTGTTTGC -3'
(R):5'- CATGGCTTCTTCAAAATTGTCTCAG -3'

Sequencing Primer
(F):5'- AGGACCATTGTTTGCACTATCCTG -3'
(R):5'- GCTTCTTCAAAATTGTCTCAGTTTTG -3'

Posted On

2015-03-18