Incidental Mutation 'R3758:Olfr745'
ID271536
Institutional Source Beutler Lab
Gene Symbol Olfr745
Ensembl Gene ENSMUSG00000050028
Gene Nameolfactory receptor 745
SynonymsGA_x6K02T2PMLR-6361495-6362481, MOR106-11
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50639388-50643885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50643036 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 252 (K252E)
Ref Sequence ENSEMBL: ENSMUSP00000050184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062534] [ENSMUST00000213127] [ENSMUST00000218546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062534
AA Change: K252E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050184
Gene: ENSMUSG00000050028
AA Change: K252E

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:7tm_4 44 324 6.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 51 191 6.6e-6 PFAM
Pfam:7tm_1 57 306 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206749
Predicted Effect possibly damaging
Transcript: ENSMUST00000213127
AA Change: K246E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216105
Predicted Effect probably benign
Transcript: ENSMUST00000218546
Meta Mutation Damage Score 0.4367 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat3 A G 17: 12,927,467 probably benign Het
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Olfr745
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr745 APN 14 50643168 missense probably benign 0.02
IGL02316:Olfr745 APN 14 50642287 missense probably benign 0.25
IGL02377:Olfr745 APN 14 50642518 splice site probably null
IGL02471:Olfr745 APN 14 50642757 missense probably benign 0.43
IGL02486:Olfr745 APN 14 50642632 missense probably damaging 1.00
IGL02517:Olfr745 APN 14 50643201 missense probably benign 0.01
R0453:Olfr745 UTSW 14 50643004 missense possibly damaging 0.90
R0727:Olfr745 UTSW 14 50643003 missense probably damaging 0.98
R0746:Olfr745 UTSW 14 50642775 splice site probably null
R1638:Olfr745 UTSW 14 50643108 missense possibly damaging 0.93
R1688:Olfr745 UTSW 14 50643248 missense probably benign 0.04
R1991:Olfr745 UTSW 14 50642866 missense possibly damaging 0.90
R2245:Olfr745 UTSW 14 50642605 missense probably damaging 1.00
R4084:Olfr745 UTSW 14 50642848 missense probably damaging 0.98
R5033:Olfr745 UTSW 14 50643162 missense probably damaging 1.00
R5211:Olfr745 UTSW 14 50643253 missense possibly damaging 0.78
R5302:Olfr745 UTSW 14 50642319 splice site probably null
R5645:Olfr745 UTSW 14 50643067 missense probably benign 0.00
R5731:Olfr745 UTSW 14 50642791 missense probably damaging 1.00
R6917:Olfr745 UTSW 14 50643223 missense possibly damaging 0.67
R7408:Olfr745 UTSW 14 50642395 missense probably benign 0.16
R7716:Olfr745 UTSW 14 50642358 missense probably benign 0.17
R7728:Olfr745 UTSW 14 50642392 missense probably benign 0.00
R8208:Olfr745 UTSW 14 50642631 missense probably benign 0.28
R8447:Olfr745 UTSW 14 50642551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCAGGACCATTGTTTGC -3'
(R):5'- CATGGCTTCTTCAAAATTGTCTCAG -3'

Sequencing Primer
(F):5'- AGGACCATTGTTTGCACTATCCTG -3'
(R):5'- GCTTCTTCAAAATTGTCTCAGTTTTG -3'
Posted On2015-03-18