Incidental Mutation 'R3758:Acat3'
ID271537
Institutional Source Beutler Lab
Gene Symbol Acat3
Ensembl Gene ENSMUSG00000062480
Gene Nameacetyl-Coenzyme A acetyltransferase 3
SynonymsACTL
MMRRC Submission 040739-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R3758 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12923833-12940402 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 12927467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043923] [ENSMUST00000089024] [ENSMUST00000151287] [ENSMUST00000160378]
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082703
Predicted Effect probably benign
Transcript: ENSMUST00000089024
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138709
Predicted Effect probably benign
Transcript: ENSMUST00000151287
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160921
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 93% (28/30)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcat1 T A 6: 145,032,872 I208F probably damaging Het
Cage1 A C 13: 38,025,729 F91V possibly damaging Het
Cd200r3 T G 16: 44,964,628 probably null Het
Coq8b C T 7: 27,242,227 Q246* probably null Het
Dmxl1 G A 18: 49,935,317 G2719D probably damaging Het
Fbln2 T C 6: 91,256,381 S616P probably damaging Het
Fkbp10 G A 11: 100,422,625 probably null Het
Gabra1 G T 11: 42,175,936 D50E probably benign Het
Hist1h1e T A 13: 23,622,257 K81* probably null Het
Hmgcs2 A G 3: 98,291,090 N103S probably damaging Het
Htt A G 5: 34,895,970 H2549R probably damaging Het
Lrba A G 3: 86,776,049 E2726G probably damaging Het
Lrrc7 T C 3: 158,163,965 N706D probably damaging Het
Mill1 G A 7: 18,262,703 probably null Het
Nipa2 T C 7: 55,935,941 Y102C probably damaging Het
Nmd3 T A 3: 69,724,308 C32* probably null Het
Olfr1251 A G 2: 89,667,572 F105L probably benign Het
Olfr582 A G 7: 103,041,970 S159G probably benign Het
Olfr745 A G 14: 50,643,036 K252E possibly damaging Het
Olfr777 T C 10: 129,269,065 D86G probably damaging Het
Pcdhb7 A G 18: 37,343,026 D405G possibly damaging Het
Ptprt A T 2: 161,812,030 L560Q probably damaging Het
Serpinb9b A G 13: 33,035,588 Y166C probably damaging Het
Soga1 T C 2: 157,020,638 N1457S possibly damaging Het
Sprr1a T G 3: 92,484,397 K99T probably damaging Het
Spsb4 A G 9: 96,995,871 V133A probably damaging Het
Suz12 A G 11: 80,024,942 T391A probably benign Het
Tor1aip2 A G 1: 156,065,289 E447G probably damaging Het
Ube4a G A 9: 44,949,900 probably benign Het
Wdfy4 A C 14: 33,023,374 H2296Q probably benign Het
Other mutations in Acat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Acat3 APN 17 12925320 missense probably benign
IGL02570:Acat3 APN 17 12940294 missense probably benign
R1340:Acat3 UTSW 17 12929677 splice site probably benign
R1747:Acat3 UTSW 17 12924808 missense possibly damaging 0.49
R1839:Acat3 UTSW 17 12928606 nonsense probably null
R2126:Acat3 UTSW 17 12927407 missense probably benign 0.00
R3790:Acat3 UTSW 17 12928573 nonsense probably null
R4206:Acat3 UTSW 17 12927386 missense possibly damaging 0.67
Z1177:Acat3 UTSW 17 12934883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGAGTTGGTATTTCCCC -3'
(R):5'- CAAAGAGCTGCTGTCCTTAGG -3'

Sequencing Primer
(F):5'- ACAGAGTTGGTATTTCCCCCAGTG -3'
(R):5'- CACAGGGTGAGCGACTCATG -3'
Posted On2015-03-18