Incidental Mutation 'F5770:Gdap1l1'
ID271552
Institutional Source Beutler Lab
Gene Symbol Gdap1l1
Ensembl Gene ENSMUSG00000017943
Gene Nameganglioside-induced differentiation-associated protein 1-like 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #F5770 (G1)
Quality Score97
Status Validated
Chromosome2
Chromosomal Location163438476-163455324 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 163447486 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018087] [ENSMUST00000109420] [ENSMUST00000109421] [ENSMUST00000137070]
Predicted Effect probably benign
Transcript: ENSMUST00000018087
SMART Domains Protein: ENSMUSP00000018087
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109420
SMART Domains Protein: ENSMUSP00000105047
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 120 3.1e-8 PFAM
Pfam:GST_N_3 49 126 1.1e-13 PFAM
Pfam:GST_N_2 55 121 7.1e-10 PFAM
Pfam:GST_C_2 206 304 3.1e-8 PFAM
transmembrane domain 340 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109421
SMART Domains Protein: ENSMUSP00000105048
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 123 1.2e-8 PFAM
Pfam:GST_N_3 49 129 3.3e-10 PFAM
Pfam:GST_N_2 62 124 7.6e-9 PFAM
Pfam:GST_C_2 182 307 8.2e-9 PFAM
Pfam:GST_C 201 311 3.4e-8 PFAM
transmembrane domain 343 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137070
SMART Domains Protein: ENSMUSP00000119421
Gene: ENSMUSG00000017943

DomainStartEndE-ValueType
Pfam:GST_N 45 120 2.3e-8 PFAM
Pfam:GST_N_3 49 126 1.6e-13 PFAM
Pfam:GST_N_2 55 121 1.1e-9 PFAM
Pfam:GST_C_2 142 246 3.1e-8 PFAM
Pfam:GST_C 146 251 1.6e-6 PFAM
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ganglioside GD3 synthase causes cell differentiation with neurite sprouting when transfected into the mouse neuroblastoma cell line Neuro2a. After differentiation, the expression of several genes is upregulated, including one that encodes a protein termed ganglioside-induced differentiation-associated protein 1 (Gdap1). A similar gene was found in humans, and mutations in the human gene are associated with Charcot-Marie-Tooth type 4A disease. The protein encoded by this gene is similar in sequence to the human GDAP1 protein. Several transcript variants encoding different isoforms, as well as a noncoding transcript variant, have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb5 T A 12: 118,886,179 M950L probably benign Het
AC139131.1 T G 7: 12,481,196 probably benign Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Arhgef38 T G 3: 133,149,540 H262P probably damaging Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Camk2g T C 14: 20,739,312 probably benign Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm20517 G A 17: 47,618,832 V65M probably damaging Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Got1 T A 19: 43,500,561 probably benign Het
Heatr5a A G 12: 51,881,278 probably benign Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Mctp2 T A 7: 72,121,751 probably benign Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rabep1 T C 11: 70,937,516 probably benign Het
Ralgapa1 G A 12: 55,795,653 probably benign Het
Rasa1 A G 13: 85,226,945 probably null Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Ttc23 T C 7: 67,709,315 probably benign Het
Ttc36 A T 9: 44,801,797 probably benign Het
Tubb3 C T 8: 123,411,675 probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Gdap1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02119:Gdap1l1 APN 2 163453668 missense probably damaging 1.00
IGL02171:Gdap1l1 APN 2 163447550 missense possibly damaging 0.78
IGL02335:Gdap1l1 APN 2 163447595 missense possibly damaging 0.50
R0091:Gdap1l1 UTSW 2 163446091 missense probably damaging 1.00
R0165:Gdap1l1 UTSW 2 163451499 critical splice acceptor site probably null
R0242:Gdap1l1 UTSW 2 163447653 nonsense probably null
R1577:Gdap1l1 UTSW 2 163438604 missense probably damaging 0.96
R2022:Gdap1l1 UTSW 2 163447597 missense probably benign 0.04
R4960:Gdap1l1 UTSW 2 163453859 missense probably benign 0.00
R6027:Gdap1l1 UTSW 2 163451611 missense possibly damaging 0.57
R6292:Gdap1l1 UTSW 2 163451507 missense probably damaging 1.00
R6678:Gdap1l1 UTSW 2 163438654 missense probably benign
R7034:Gdap1l1 UTSW 2 163446145 missense probably damaging 1.00
R7173:Gdap1l1 UTSW 2 163438688 missense probably damaging 0.99
R7195:Gdap1l1 UTSW 2 163446130 missense probably damaging 1.00
Z1176:Gdap1l1 UTSW 2 163447670 missense
Predicted Primers
Posted On2015-03-23