Incidental Mutation 'F5770:Arhgef38'
ID271553
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene NameRho guanine nucleotide exchange factor (GEF) 38
SynonymsD630013G24Rik, 9130221D24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #F5770 (G1)
Quality Score23
Status Validated
Chromosome3
Chromosomal Location133112278-133234949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 133149540 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 262 (H262P)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147041]
Predicted Effect probably damaging
Transcript: ENSMUST00000147041
AA Change: H262P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: H262P

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Meta Mutation Damage Score 0.6625 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (96/97)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik A T 4: 122,701,257 H102L possibly damaging Het
Abcb5 T A 12: 118,886,179 M950L probably benign Het
AC139131.1 T G 7: 12,481,196 probably benign Het
Ahcy G A 2: 155,064,921 R151* probably null Het
Atp6v1h A G 1: 5,124,443 T282A possibly damaging Het
Camk2g T C 14: 20,739,312 probably benign Het
Casp8ap2 C T 4: 32,639,944 H333Y probably benign Het
Cd36 ACTGTCTGT ACTGT 5: 17,820,528 probably null Het
Cdc42bpb C T 12: 111,296,391 G1501S probably benign Het
Cfi T A 3: 129,854,992 I175K possibly damaging Het
Clasp1 G A 1: 118,581,348 R1027Q probably damaging Het
D630003M21Rik T C 2: 158,201,011 T870A probably benign Het
Dcaf4 C A 12: 83,537,701 probably null Het
Dnah12 T A 14: 26,773,093 N1369K possibly damaging Het
Dnajc22 T A 15: 99,101,482 Y183N probably damaging Het
Dpyd C T 3: 118,897,126 Q295* probably null Het
Erv3 T C 2: 131,855,926 H171R possibly damaging Het
Fam221b T C 4: 43,665,865 T249A probably benign Het
Fbrsl1 C T 5: 110,379,426 A129T possibly damaging Het
Fcgr1 T C 3: 96,284,276 *405W probably null Het
Gdap1l1 C T 2: 163,447,486 probably benign Het
Glrx3 A G 7: 137,459,153 H172R probably benign Het
Gm10770 T A 2: 150,179,484 K38* probably null Het
Gm20517 G A 17: 47,618,832 V65M probably damaging Het
Gm4787 G A 12: 81,377,567 Q606* probably null Het
Golga4 A G 9: 118,556,075 E727G possibly damaging Het
Got1 T A 19: 43,500,561 probably benign Het
Heatr5a A G 12: 51,881,278 probably benign Het
Hira G A 16: 18,894,821 A29T probably damaging Het
Hnrnpab A T 11: 51,602,624 N252K probably benign Het
Ing1 T C 8: 11,561,934 V124A probably damaging Het
Izumo4 A T 10: 80,703,891 T155S probably benign Het
Kcnb2 A G 1: 15,710,091 I396V probably benign Het
Klc1 A T 12: 111,774,572 I161F probably benign Het
Lpar5 C A 6: 125,081,727 A137E possibly damaging Het
Lrp4 C T 2: 91,488,518 S900L possibly damaging Het
Lrrc37a T G 11: 103,455,512 N3176T possibly damaging Het
Mbd5 A G 2: 49,316,410 D1713G probably damaging Het
Mctp2 T A 7: 72,121,751 probably benign Het
Muc6 T G 7: 141,647,613 E808A probably benign Het
Mylk G T 16: 34,995,204 probably null Het
Myrfl T C 10: 116,861,530 T30A probably damaging Het
Nbeal2 A G 9: 110,637,937 V670A possibly damaging Het
Nphp3 T C 9: 104,035,894 probably null Het
Numbl T C 7: 27,279,602 S379P probably benign Het
Olfr1406 G T 1: 173,183,964 L157I probably benign Het
Olfr1440 G A 19: 12,394,550 V96I probably benign Het
Olfr480 G T 7: 108,066,678 T40K probably benign Het
Otop3 T A 11: 115,344,838 L432Q probably damaging Het
Papln C T 12: 83,778,834 R608C possibly damaging Het
Pelp1 T A 11: 70,398,150 T257S probably damaging Het
Pigx T C 16: 32,087,422 D129G probably damaging Het
Pik3cd A C 4: 149,657,319 L390R probably damaging Het
Plekhb1 T C 7: 100,654,618 T112A probably benign Het
Ppwd1 A G 13: 104,220,237 Y257H probably damaging Het
Prkcb G T 7: 122,528,476 W274C probably damaging Het
Rabep1 T C 11: 70,937,516 probably benign Het
Ralgapa1 G A 12: 55,795,653 probably benign Het
Rasa1 A G 13: 85,226,945 probably null Het
Rbbp8nl T A 2: 180,278,208 T558S probably benign Het
Recql4 T C 15: 76,706,169 D705G possibly damaging Het
Ror1 A G 4: 100,440,933 Q501R probably damaging Het
Rundc3b TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 5: 8,622,549 probably benign Het
Sirpb1b A G 3: 15,503,183 V366A probably benign Het
Slc30a4 T A 2: 122,689,538 M136L probably benign Het
Slc5a6 C T 5: 31,042,613 probably null Het
Spaca1 T C 4: 34,039,311 E192G probably damaging Het
Spata31 C A 13: 64,921,648 P537T probably benign Het
Sptbn2 C T 19: 4,750,632 R2292C probably damaging Het
Thbd A T 2: 148,407,190 Y253N probably benign Het
Tiam1 C T 16: 89,865,271 R653H probably damaging Het
Tmc3 T C 7: 83,622,505 V955A probably benign Het
Tnrc6c G A 11: 117,723,326 R770H probably damaging Het
Toe1 A T 4: 116,806,111 N56K probably damaging Het
Tprkb A G 6: 85,928,782 K150E probably damaging Het
Trps1 T C 15: 50,831,577 K150E probably damaging Het
Tspyl3 A G 2: 153,225,060 V86A probably benign Het
Ttc23 T C 7: 67,709,315 probably benign Het
Ttc36 A T 9: 44,801,797 probably benign Het
Tubb3 C T 8: 123,411,675 probably benign Het
Vmn2r68 C T 7: 85,221,880 V732I probably benign Het
Vps18 A G 2: 119,297,228 Y844C probably benign Het
Wdr60 A C 12: 116,211,840 S906A possibly damaging Het
Wdr72 T A 9: 74,157,270 I528N probably damaging Het
Zfp292 C T 4: 34,806,783 C2087Y possibly damaging Het
Zfp933 G A 4: 147,826,470 A223V probably damaging Het
Zmynd8 G A 2: 165,812,394 R724* probably null Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 intron probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
Predicted Primers
Posted On2015-03-23